ID: 933862917

View in Genome Browser
Species Human (GRCh38)
Location 2:86487890-86487912
Sequence GCCACAGTGCAAAACGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933862917_933862921 13 Left 933862917 2:86487890-86487912 CCTTGCTCGTTTTGCACTGTGGC 0: 1
1: 0
2: 0
3: 8
4: 141
Right 933862921 2:86487926-86487948 GCAGGCAGCCAGTCCTGCTGAGG 0: 1
1: 0
2: 6
3: 35
4: 368
933862917_933862920 -5 Left 933862917 2:86487890-86487912 CCTTGCTCGTTTTGCACTGTGGC 0: 1
1: 0
2: 0
3: 8
4: 141
Right 933862920 2:86487908-86487930 GTGGCACTGGCTGGATCAGCAGG 0: 1
1: 0
2: 1
3: 20
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933862917 Original CRISPR GCCACAGTGCAAAACGAGCA AGG (reversed) Intronic
900429037 1:2593353-2593375 GCCACAGGGGAAAACCAGCTGGG + Intronic
901175496 1:7295787-7295809 GCCACAGAGAAAATAGAGCAGGG + Intronic
902758912 1:18568027-18568049 ACCACATTGCAAAAAGAGTATGG - Intergenic
903222975 1:21879076-21879098 GCCACAGTGCAACAAGTGCAAGG - Exonic
905175262 1:36131235-36131257 GGCTCAGTGCAAAATGAACATGG - Intergenic
910475138 1:87598013-87598035 GCCAGAATACAAAACAAGCATGG - Intergenic
915996351 1:160567986-160568008 GGCCCAGTGCAAAACGAAAATGG - Intronic
917908425 1:179613649-179613671 CCCACAATGCAAAAGGGGCAAGG + Intronic
917953305 1:180064125-180064147 GCCAGAGTCCAAAGAGAGCAAGG - Intronic
920295225 1:204951986-204952008 GCAACAGTGCACAGGGAGCATGG - Intronic
922965359 1:229686381-229686403 GACACAGTGCAAGCCTAGCATGG - Intergenic
923085303 1:230698625-230698647 GCCCCAGAGCAAAACGGGCCTGG + Intergenic
1063680574 10:8183702-8183724 TCCACAGTGGATAATGAGCAGGG + Intergenic
1063942805 10:11147964-11147986 GCCACAGGGCAGAATGAGGAAGG + Intronic
1065155225 10:22862726-22862748 GCTACAGTGTAAAAGGACCAAGG - Intergenic
1071436248 10:85650510-85650532 GGCACAGTGCACACCAAGCAAGG + Intronic
1072632230 10:97154332-97154354 GCCTCAGTGCAAACTAAGCAGGG + Intronic
1075554863 10:123423052-123423074 GCCAAAGTGCACAAAGAACAGGG + Intergenic
1075976621 10:126701680-126701702 GCCACAGTGTAGAAAGAGGAGGG - Intergenic
1076148523 10:128144550-128144572 GCCACTGTGCAAAAGCAGAAGGG + Intergenic
1078070731 11:8107836-8107858 GCCACAGTGCCAAAAGGCCAGGG + Intronic
1078103281 11:8342850-8342872 ACCAAAGAGCAAAAGGAGCATGG + Intergenic
1080651811 11:34228701-34228723 GTCACTGTGGAAAACAAGCATGG - Intronic
1089707152 11:120286938-120286960 GCCACAGTGGACCACAAGCAGGG + Intronic
1089727641 11:120496648-120496670 GCTACAGTGGAAACAGAGCAAGG - Intergenic
1090921912 11:131214358-131214380 GTCACAGGGCAAGAAGAGCAGGG + Intergenic
1096783156 12:54002264-54002286 GACAGAATGCAAAACGAGGAAGG + Intronic
1098514162 12:71354389-71354411 GCCACAGTGCAGAAAGGGCAGGG + Intronic
1108559818 13:51631736-51631758 CCCACAGTTCAAAACCAGCCTGG - Intronic
1109283589 13:60385742-60385764 GCCACACTGTAAGAAGAGCATGG + Intergenic
1110043498 13:70797166-70797188 GCCTGAGAGCAAAACAAGCATGG - Intergenic
1112284998 13:98096333-98096355 GCCACAGTGGAAGACGGGGAGGG + Intergenic
1114739301 14:25078914-25078936 GCCACAGTGCAAATACAGGAAGG - Intergenic
1114853986 14:26415325-26415347 GCCAAAGTGAAAAAGGAGTAAGG - Intergenic
1115269826 14:31539450-31539472 GCCACTGTCCAAACCCAGCAAGG - Intronic
1120062680 14:80002574-80002596 GCCACAGGGGCAAATGAGCAGGG + Intergenic
1122444849 14:101761164-101761186 GCCTCAGTGCAAAGCGTGCCAGG + Intergenic
1126622220 15:50651508-50651530 GCCACCGTGCCCAACAAGCATGG - Intronic
1127104458 15:55598090-55598112 GCCAGAGAGCATAAAGAGCAAGG - Intergenic
1128111127 15:65076883-65076905 GCCACAGTGCTCCACCAGCAGGG - Exonic
1136238109 16:28927077-28927099 GCCACTCTGCAAAAAGAGTATGG + Intronic
1137624774 16:49900683-49900705 GCCACACAGCAGAAGGAGCAGGG - Intergenic
1139402499 16:66694296-66694318 CCCACAGTGCAAACAAAGCAAGG + Intronic
1145235477 17:21205116-21205138 GCCACAGTGAAAACTCAGCAGGG + Intronic
1145394431 17:22483557-22483579 GCCACTGTGGAAAATCAGCATGG - Intergenic
1149621023 17:58045133-58045155 GCCACAGAGCATAATGAGAATGG - Intergenic
1150090451 17:62319952-62319974 GACACAGTGCAAGAAGGGCAAGG + Intergenic
1150469842 17:65427560-65427582 GTCACAGTGTAAGAAGAGCATGG + Intergenic
1150737548 17:67753289-67753311 GCCACAGTGGAAATGGAGCAGGG - Intergenic
1151332601 17:73419658-73419680 GCCAGAGTTCAAAACCAGCCTGG + Intronic
1154199784 18:12291363-12291385 GCCACAGGGAAAGATGAGCAGGG + Intergenic
1155554042 18:26998201-26998223 GCCACAATAAAATACGAGCAGGG - Intronic
1155766143 18:29635423-29635445 GCTAAACTGCAAAAGGAGCAGGG - Intergenic
1159638638 18:70837253-70837275 GCCACAATGGAAAACTAACATGG - Intergenic
1160376619 18:78418570-78418592 GCCACTGTGCAACTCCAGCAGGG - Intergenic
1161572355 19:5037511-5037533 GCCACAGTGCAAAAGGCGCCTGG - Intronic
1166437608 19:42782001-42782023 GCTACAGTTCAAAGAGAGCATGG - Intronic
1166456561 19:42945799-42945821 GCTACAGTTCAAAGAGAGCATGG - Intronic
926391552 2:12399252-12399274 TCTAAAGTGCAAAACAAGCATGG - Intergenic
926806729 2:16717919-16717941 CCCTCAGTGCAAAGCGAGCCTGG - Intergenic
928221318 2:29405564-29405586 GCCACTGTGCAAACACAGCAAGG + Intronic
932056989 2:68455702-68455724 GCCACAGTGCAAATTGAGGTGGG - Intergenic
932897915 2:75661461-75661483 GGCACATTGAAAAACAAGCAGGG - Intronic
933434717 2:82234189-82234211 AGCACAGTGGAAAAAGAGCATGG - Intergenic
933862917 2:86487890-86487912 GCCACAGTGCAAAACGAGCAAGG - Intronic
934044471 2:88161041-88161063 GCCTGAGTGCAGAAGGAGCAGGG - Intergenic
935466458 2:103404143-103404165 GCCACGAAGCAAAGCGAGCATGG + Intergenic
935620176 2:105122867-105122889 GTGACTGTGCAAAGCGAGCATGG + Intergenic
935838940 2:107087555-107087577 GCCACTGTGCCAGACCAGCAGGG - Intergenic
935976990 2:108587802-108587824 GACACAGTGCAGAAGCAGCAAGG - Intronic
936801662 2:116276200-116276222 GCCACAATGCAAAAAGAGTATGG - Intergenic
938451927 2:131428675-131428697 GCAACAGAGGAAAAGGAGCAAGG + Intergenic
939337308 2:140846752-140846774 CCCACAGTGCAAGAAGAGAAAGG + Intronic
943792662 2:191951987-191952009 GACACAGTGCAGTATGAGCATGG + Intronic
944043499 2:195382384-195382406 GTCACAGAGGAAAATGAGCAAGG + Intergenic
944786992 2:203081889-203081911 CCCAGAGTTCAAAACGAGCCTGG + Intronic
1172845406 20:37927400-37927422 GCCACACTGCAAGGCGCGCATGG - Intronic
1174197811 20:48785932-48785954 GCCACAGGGCAGAAAGAGCCGGG + Intronic
1174858947 20:54072014-54072036 GGCACCCTGCAAAACGAGGATGG + Intergenic
1175637353 20:60596894-60596916 CCCACAGTGGAAAACCAGCTAGG - Intergenic
1180825047 22:18856059-18856081 GCCACAGTGCAGAGGGAGGAGGG + Intronic
1180997724 22:19973753-19973775 GCCACAGTGCGCAAAGAGCGCGG - Exonic
1181023704 22:20116241-20116263 GGCACCATGCAAAACGCGCAGGG + Exonic
1181187683 22:21118489-21118511 GCCACAGTGCAGAGGGAGGAGGG - Intergenic
1181211515 22:21292004-21292026 GCCACAGTGCAGAGGGAGGAGGG + Intergenic
1181500736 22:23314253-23314275 GCCACAGTGCAGAGAGAGGAGGG - Intronic
1181705962 22:24649564-24649586 GCCACAGTGCAGAGGGAGGAGGG - Intergenic
1203215434 22_KI270731v1_random:3427-3449 GCCACAGTGCAGAGGGAGGAGGG - Intergenic
1203275192 22_KI270734v1_random:81964-81986 GCCACAGTGCAGAGGGAGGAGGG + Intergenic
951607634 3:24453464-24453486 GAGACAGTGGAAAACGAGTAAGG - Intronic
953839570 3:46378555-46378577 GCCACATTGGCAAACCAGCAAGG + Intergenic
954662041 3:52231484-52231506 GCCACAGTGAAAAAGGAGTTTGG - Exonic
955946391 3:64198619-64198641 GCCCCAGTGGAAAATGAGGAAGG - Intronic
956642379 3:71427319-71427341 CACACAGAGCAAAAGGAGCAGGG + Intronic
960209292 3:114940160-114940182 GTCACAGTGTAAAATGAGAAAGG + Intronic
963030335 3:140966413-140966435 GCCATAGTGCAAAAGGTGAAAGG + Intronic
964193876 3:154039066-154039088 GGAACAGGGCAAAAAGAGCATGG - Intergenic
966405228 3:179590529-179590551 GCAACAGTGGAAAATAAGCAAGG + Intronic
968600208 4:1505164-1505186 GCCACAGGGCAATTGGAGCAGGG + Intergenic
969096719 4:4738156-4738178 GCCACACTGCAAAGTGAGCATGG - Intergenic
969124716 4:4938188-4938210 GCCAGAGTGCAAAATGAAAATGG + Intergenic
969843292 4:9899783-9899805 GCCAAAGTGCAAAACAGACATGG + Intronic
972291433 4:37693661-37693683 GCCACAGGGAAAAAGAAGCAAGG - Intergenic
972934109 4:44110311-44110333 GATACAGTACAAAACCAGCATGG - Intergenic
975587788 4:75968024-75968046 GCCACAGAGCAAAAGTAGGATGG + Intronic
981521328 4:145665640-145665662 GCCACAGTTCAAGACCAGCCTGG + Intergenic
987230238 5:15886385-15886407 GCCATAGTGAGAAAAGAGCAAGG - Intronic
988694091 5:33602093-33602115 TCCACAGAGCACACCGAGCAAGG + Intronic
992206486 5:74435149-74435171 GCCAGAGTGCAAATGCAGCAAGG + Intergenic
992356719 5:75993355-75993377 GCTACTATGCAAAGCGAGCATGG + Intergenic
993050988 5:82925739-82925761 GCCACATGGCAAAAAGAACAGGG - Intergenic
995938373 5:117547042-117547064 GTCATAGTGCAAAACTACCATGG - Intergenic
996518126 5:124396198-124396220 GCCACAGTGCAAGGCAAGGAAGG + Intergenic
999724469 5:154424654-154424676 AGCCCAGTTCAAAACGAGCATGG + Intergenic
1002335678 5:178476625-178476647 GCCACAGTGGAAGAGGAGCACGG - Intronic
1002901920 6:1416716-1416738 GCCAGAGTTCAAGACGAGCCTGG + Intergenic
1006120657 6:31803066-31803088 GCCACAGAGCAAGACAAGTACGG - Intronic
1008204987 6:48643900-48643922 GACACAGTGCAAGAGGAGTACGG + Intergenic
1010560972 6:77350108-77350130 GCCACAGTGCAAATTAACCATGG + Intergenic
1013824020 6:114189688-114189710 GCCTCAGTGGAAAAAGAGTATGG - Intronic
1018332389 6:162744385-162744407 GCTACAGTTCAAAACCAGCCTGG + Intronic
1018702867 6:166441235-166441257 GCCACAGTGGAAACAGAGAAAGG - Intronic
1019301722 7:307856-307878 ACCACAATGCAAAATGAGGAGGG + Intergenic
1023155624 7:37248712-37248734 GGTAAAGTGCAAAACGTGCATGG + Intronic
1023224774 7:37957915-37957937 GCGACAGAGGAAAAGGAGCAAGG + Intronic
1023496022 7:40797899-40797921 GCCATAGGGCAAGACAAGCAGGG - Intronic
1025912944 7:65842010-65842032 GCCACTGTGAAAAAGGAGCTGGG - Intergenic
1027961364 7:84950120-84950142 ACCACAGTGCAAAAAAATCAGGG - Intergenic
1029812619 7:103064650-103064672 GGCACATTGCAAAAAGAACATGG - Intronic
1030049614 7:105526039-105526061 GCTAAAATGCAAAACGAGTAAGG - Intergenic
1033399956 7:141013278-141013300 GCCACATTCCAAAATGGGCATGG - Intronic
1035155532 7:156909127-156909149 GCCACCGTGCAGAACGCGCGCGG + Intergenic
1035414783 7:158673756-158673778 GTCACAGTGCAAGAGGCGCACGG + Intronic
1041184602 8:55286131-55286153 GCCCCAGTGCAAAACAAAGAGGG + Intronic
1041738958 8:61138986-61139008 GCTTCAGTGCAACAAGAGCAAGG - Intronic
1044418367 8:91962062-91962084 ACCACTGTGCAAAACGTGCAAGG + Intronic
1047396908 8:124509075-124509097 GCCACTGGGCAAAATGAACAAGG + Intronic
1048264382 8:132972667-132972689 GCCACAGTCCAAAATGCGCCAGG - Exonic
1051823041 9:21191194-21191216 GCCACAGTGGCAAAGCAGCAGGG + Intergenic
1051824869 9:21209729-21209751 GCCACAGTGGCAAAGCAGCAGGG + Intronic
1051826865 9:21231806-21231828 GCCACAGTGGCAAAGCAGCAGGG + Intronic
1056065054 9:82925116-82925138 GCCACAGGGCAAAAAGAAAATGG - Intergenic
1057509303 9:95664240-95664262 GGCACAGTGCAAAATGAAAATGG + Intergenic
1059565131 9:115376776-115376798 AGCCCAGTGCAAAACAAGCAGGG + Intronic
1060918872 9:127406680-127406702 GAGACAGGGCAAAGCGAGCATGG - Intronic
1061418071 9:130458754-130458776 GCCACAGTGCACAGAGCGCAGGG - Intronic
1187075580 X:15931177-15931199 GCCACAGTGGAAAAAAGGCATGG + Intergenic
1188417645 X:29955712-29955734 GCCACAGACAAAATCGAGCAGGG + Exonic
1196807634 X:119602920-119602942 GCCAGAGGGAAAAAAGAGCAAGG + Intronic
1201697576 Y:16842749-16842771 GGCACAGAGCAAAAAGTGCAGGG - Intergenic