ID: 933863283

View in Genome Browser
Species Human (GRCh38)
Location 2:86491777-86491799
Sequence GACCTACTCACAGTGAGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 79}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933863283_933863285 3 Left 933863283 2:86491777-86491799 CCTGTACTCACTGTGAGTAGGTC 0: 1
1: 0
2: 1
3: 5
4: 79
Right 933863285 2:86491803-86491825 GTGGTATCAAAACCTCTAAAAGG 0: 1
1: 0
2: 0
3: 9
4: 114
933863283_933863291 30 Left 933863283 2:86491777-86491799 CCTGTACTCACTGTGAGTAGGTC 0: 1
1: 0
2: 1
3: 5
4: 79
Right 933863291 2:86491830-86491852 AAATGAGTTCTTGAAATCATGGG 0: 1
1: 0
2: 3
3: 32
4: 327
933863283_933863288 6 Left 933863283 2:86491777-86491799 CCTGTACTCACTGTGAGTAGGTC 0: 1
1: 0
2: 1
3: 5
4: 79
Right 933863288 2:86491806-86491828 GTATCAAAACCTCTAAAAGGGGG 0: 1
1: 0
2: 1
3: 12
4: 174
933863283_933863287 5 Left 933863283 2:86491777-86491799 CCTGTACTCACTGTGAGTAGGTC 0: 1
1: 0
2: 1
3: 5
4: 79
Right 933863287 2:86491805-86491827 GGTATCAAAACCTCTAAAAGGGG 0: 1
1: 0
2: 0
3: 10
4: 136
933863283_933863290 29 Left 933863283 2:86491777-86491799 CCTGTACTCACTGTGAGTAGGTC 0: 1
1: 0
2: 1
3: 5
4: 79
Right 933863290 2:86491829-86491851 AAAATGAGTTCTTGAAATCATGG 0: 1
1: 0
2: 3
3: 36
4: 450
933863283_933863286 4 Left 933863283 2:86491777-86491799 CCTGTACTCACTGTGAGTAGGTC 0: 1
1: 0
2: 1
3: 5
4: 79
Right 933863286 2:86491804-86491826 TGGTATCAAAACCTCTAAAAGGG 0: 1
1: 0
2: 1
3: 13
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933863283 Original CRISPR GACCTACTCACAGTGAGTAC AGG (reversed) Intronic
903197436 1:21701562-21701584 GAACTACTCACATTCAGTTCCGG + Exonic
905143276 1:35866181-35866203 TACCTAGTCACAGTAAGTGCAGG + Intergenic
907571231 1:55486054-55486076 AAACTACTCTCAGTGAGTGCAGG - Intergenic
910284940 1:85543395-85543417 GACTTGCTCACAGTGAACACAGG + Intronic
1063003544 10:1946651-1946673 CACTTACTCACAGTGAATACTGG + Intergenic
1070733134 10:78845449-78845471 GACCTGCTCTCAGTGATTAGGGG - Intergenic
1072816707 10:98516795-98516817 GACCTTCACACTGTGAGTAGGGG + Intronic
1073372962 10:103007189-103007211 GACCTACTCCCTGTTCGTACAGG - Intronic
1091157911 11:133390804-133390826 GACTTACTCACAGGAAGTACTGG - Intronic
1099924290 12:88998640-88998662 GACTTACTCACAGTCAGTACTGG + Intergenic
1101497677 12:105270871-105270893 GACCAAATTCCAGTGAGTACTGG + Intronic
1103301867 12:119933854-119933876 GACCTACCCACCCTGAGTGCTGG + Intergenic
1103432944 12:120903834-120903856 GACCTACTCGTGGTGAGTGCGGG - Exonic
1107143606 13:37032704-37032726 GAGGTTCTCACAGTGACTACCGG + Intronic
1113738123 13:112692069-112692091 GACCCAATCACAGTGACTATAGG + Intronic
1119526358 14:75325648-75325670 AAAATACTCACAGTGAGTATGGG - Intergenic
1122316900 14:100831083-100831105 GTCCTGCTCCCAGTGAGTAATGG + Intergenic
1126398484 15:48244624-48244646 GAACTACTCACAGTGAACAGAGG + Intronic
1126398546 15:48245347-48245369 GAACTACTCACAGTGAACAGAGG - Intronic
1132405332 15:101538575-101538597 CAGCTATTCAAAGTGAGTACTGG + Intergenic
1140883158 16:79217545-79217567 GACCAACTTACAGTCAGAACAGG - Intergenic
1144546661 17:16202767-16202789 GACCCACTAACAGAGACTACAGG + Intronic
1145299715 17:21624563-21624585 GACCCACTAACAGAGACTACAGG - Intergenic
1145350568 17:22078708-22078730 GACCCACTAACAGAGACTACAGG + Intergenic
1147421263 17:40323190-40323212 CACCTACTCAGACTGAGTGCTGG + Intronic
1149649420 17:58267669-58267691 GCCCTACTCACACTGAGATCCGG - Intronic
1155100864 18:22608433-22608455 CACCTGCTCACAGTGAGACCTGG + Intergenic
1157697098 18:49731517-49731539 GCCTTACTCTCAGTAAGTACAGG - Intergenic
1158393563 18:57062765-57062787 TCCCTACTCACAATGACTACAGG + Intergenic
1158893174 18:61892261-61892283 GACATGCTAGCAGTGAGTACTGG - Intronic
1161160044 19:2756834-2756856 CACCTGCTCACAGTGAGAAAAGG + Intronic
1164447924 19:28333539-28333561 CAGCCACTCACAGTGATTACTGG + Intergenic
1165024407 19:32949150-32949172 GAGCTACTCTCAGTCAGTAGAGG - Intronic
1166923664 19:46250430-46250452 GAGGTTCTCACAGTGAATACCGG - Intergenic
926822779 2:16871479-16871501 GACCTCCTCACATTGGGTTCTGG + Intergenic
933863283 2:86491777-86491799 GACCTACTCACAGTGAGTACAGG - Intronic
934896201 2:98122233-98122255 GACCTTCCCACAGGGAGTCCAGG - Intronic
937364132 2:121248741-121248763 GACCTGCTCACAGGGAGTTCAGG - Intronic
945642007 2:212442607-212442629 GTCCTACTTACAGTGGGTTCAGG + Intronic
1171560825 20:26123715-26123737 GACCCACTAACAGAGACTACAGG + Intergenic
1172697154 20:36830819-36830841 GGCCTGCACACAGTGAGTTCTGG + Intronic
1176421655 21:6520897-6520919 GTCCTTCCCACAGTGAGCACTGG - Intergenic
1176650397 21:9541369-9541391 GACCCACTAACAGAGACTACAGG - Intergenic
1179697145 21:43129213-43129235 GTCCTTCCCACAGTGAGCACTGG - Intergenic
1184300434 22:43555679-43555701 GACCTCCCCACAGTGGGCACGGG + Intronic
950065842 3:10111085-10111107 GACCAACTCAAAGTGAAGACAGG + Intergenic
952033424 3:29171870-29171892 GACTTCCTCACAGGCAGTACGGG + Intergenic
953819086 3:46188811-46188833 ACCCTACTGACAGTGAGTTCTGG - Intronic
954903423 3:54039984-54040006 GCCCTACTCACAGTGATTGCAGG + Intergenic
957743351 3:84304307-84304329 GACCTACCCACAGTGTGGGCGGG + Intergenic
959407304 3:105976149-105976171 GACCTACTCACAATGAGAGAGGG + Intergenic
960245595 3:115396927-115396949 GACCTACTCAGAATCATTACTGG + Intergenic
961333047 3:126154223-126154245 GGCCAAGTCAGAGTGAGTACTGG + Intronic
965290665 3:166874299-166874321 AACCAACTCATAGTGAGTAAAGG + Intergenic
965805542 3:172537752-172537774 GTCCTACACACAGTGAGTATAGG + Intergenic
967411054 3:189167013-189167035 GAGCTGCTCACAGTGTGAACTGG + Intronic
972874348 4:43339993-43340015 AAACTACTCAAACTGAGTACAGG - Intergenic
975465189 4:74700848-74700870 GACAAGCTCACGGTGAGTACAGG + Intergenic
976735707 4:88306955-88306977 GACATACTCAGAGTGGGTAAGGG - Intergenic
979293856 4:119008197-119008219 GCCCTTCTCACTGTGGGTACTGG + Intronic
990683141 5:58268566-58268588 CACCCACTCACAGTGAGCAAAGG + Intergenic
997735102 5:136207508-136207530 GACCTGCCCACAGTGTCTACTGG + Intergenic
999374685 5:151078804-151078826 GACCAAATCACAGCGGGTACAGG + Intronic
1001683560 5:173576231-173576253 GTGCCACTCAGAGTGAGTACGGG + Intergenic
1007228015 6:40328347-40328369 GACCTACTCACGGTAAGGGCTGG + Intergenic
1008594463 6:53027525-53027547 CACCTCCTCACAGTGAGAATGGG + Intronic
1010673921 6:78719729-78719751 GGCTTACTGCCAGTGAGTACAGG - Intergenic
1022906313 7:34861147-34861169 GCCCTACTCACACTGGGGACAGG + Intronic
1024349623 7:48350287-48350309 GACCCTCTCACAGAGAGTTCAGG - Intronic
1024721674 7:52143895-52143917 GTCCAACTCACAGTGAGCCCAGG + Intergenic
1025277014 7:57591673-57591695 GACCCACTAACAGAGACTACAGG - Intergenic
1035261382 7:157663616-157663638 GAGCTCCTCACAGTGGGGACCGG + Intronic
1036904693 8:12698394-12698416 GTCCTTCTCTCAGTAAGTACTGG - Intergenic
1040060511 8:43099640-43099662 GACCTTATCACAGTCAGCACAGG - Intronic
1042297618 8:67238832-67238854 ACCTTACTCACAGTGAGTTCCGG - Exonic
1044469854 8:92554138-92554160 GACCTCCTCACAGTGAATCTTGG - Intergenic
1045502224 8:102752258-102752280 ACCTTACTCACTGTGAGTACGGG - Intergenic
1046063747 8:109172677-109172699 GGCCTAGACACAGGGAGTACTGG - Intergenic
1048084646 8:131163443-131163465 GACTTATTCACGGTGCGTACAGG + Intergenic
1058311335 9:103506909-103506931 AAGCTAGTCACAGAGAGTACTGG + Intergenic
1060240943 9:121902655-121902677 GACTTACTCAAACTCAGTACAGG - Intronic
1203628137 Un_KI270750v1:44923-44945 GACCCACTAACAGAGACTACAGG - Intergenic
1186720845 X:12301919-12301941 AAGCTACATACAGTGAGTACCGG - Intronic
1189091932 X:38092634-38092656 GACCTACTCTCAGTGTGGAGTGG - Intronic
1194214359 X:91110393-91110415 TACCTACTCAGAGGGACTACTGG + Intergenic
1197024785 X:121736205-121736227 GACCTACTCACAGAGGCTTCAGG + Intergenic