ID: 933866856

View in Genome Browser
Species Human (GRCh38)
Location 2:86527362-86527384
Sequence CTTTATTCATAGAGGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 375}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933866851_933866856 28 Left 933866851 2:86527311-86527333 CCTCTGCTTTCATCTCTACAATT 0: 1
1: 0
2: 1
3: 43
4: 428
Right 933866856 2:86527362-86527384 CTTTATTCATAGAGGGAAAAAGG 0: 1
1: 0
2: 1
3: 22
4: 375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933866856 Original CRISPR CTTTATTCATAGAGGGAAAA AGG Intronic
901899043 1:12342275-12342297 CTTTAGGGATAGAGGGAGAATGG - Intronic
902915824 1:19638674-19638696 CCTTTTTCATAGAGGAAAAAAGG - Intronic
904124754 1:28230318-28230340 CTGTTTTCATAGAGTGAAGAGGG - Intronic
906362453 1:45175363-45175385 CTTTAATTATAAGGGGAAAAAGG - Intronic
906999448 1:50835152-50835174 CTTCATTGATAGAATGAAAATGG - Intronic
908649765 1:66319338-66319360 CTTTATTTGTAGAATGAAAATGG - Intronic
908851354 1:68379914-68379936 CTTCAGGCAAAGAGGGAAAAGGG + Intergenic
909978843 1:82074082-82074104 GTTTATTCATACAGGGAGTAAGG - Intergenic
910921211 1:92349547-92349569 CTTTATTCTTAAAGGAAATAAGG + Intronic
912221898 1:107687819-107687841 CTTTATTCTGAGAGGTAACATGG + Intronic
912516306 1:110218652-110218674 CTTCATTTATAAAGTGAAAAAGG - Intronic
912550414 1:110481858-110481880 CGTGATTCTTAGAGGTAAAAGGG + Intergenic
913126839 1:115798807-115798829 CTTTATTCCTAAAGGAAAACAGG + Intergenic
914936235 1:151982933-151982955 CTTTATTTATTGAGGGCAAGGGG + Exonic
914951340 1:152117383-152117405 CTTCATTCAGAGAGGAGAAAGGG - Intergenic
917103904 1:171473036-171473058 CTTTATTAACAGTGTGAAAACGG - Intergenic
917681252 1:177370260-177370282 CTTTATTTATAAAGAGAAAAAGG + Intergenic
919224907 1:194684405-194684427 CTTTGTTCATATAAGCAAAAAGG + Intergenic
919418435 1:197340835-197340857 CTTTATTAGCAGAGTGAAAATGG - Intronic
921403405 1:214752041-214752063 CTTTAATCTTAGAGTGGAAAAGG - Intergenic
921693114 1:218176183-218176205 TTTTAGACATAGAGGGAAAACGG + Intergenic
921837070 1:219789217-219789239 CTATTTTGATAGAAGGAAAATGG + Intronic
922354616 1:224764007-224764029 CTTTATTCTTAAGAGGAAAAGGG + Intergenic
922857330 1:228786105-228786127 GATTATTCATAGACAGAAAACGG + Intergenic
924787683 1:247214199-247214221 CTTTATTAATATACAGAAAATGG + Intergenic
1063868469 10:10392804-10392826 CTTTATCCACAGCGTGAAAACGG - Intergenic
1063907697 10:10798013-10798035 CTTTAAACATAAAGAGAAAAGGG - Intergenic
1064320948 10:14304061-14304083 CATTATTCATAGTGGCCAAAAGG - Intronic
1064695519 10:17961373-17961395 AATTATTCTTAGAGGAAAAAAGG + Intronic
1064994234 10:21282384-21282406 CTTTGGTCACAGAGGCAAAAGGG + Intergenic
1066038820 10:31523918-31523940 CTTTCATCCTAGAGGGAGAAAGG - Exonic
1067931616 10:50567796-50567818 CTTTTTCCACAGGGGGAAAAGGG + Intronic
1068091710 10:52440384-52440406 TGTTATTCATAGATGGGAAATGG - Intergenic
1068358026 10:55936676-55936698 TTTCATTCATAGCGAGAAAAAGG - Intergenic
1068924252 10:62518348-62518370 GTTTACTCGTGGAGGGAAAAAGG - Intronic
1071391494 10:85179744-85179766 TTTTACTCAGAAAGGGAAAAGGG - Intergenic
1072786971 10:98290269-98290291 CTTCATTTATTGAGGGACAAAGG + Intergenic
1073383695 10:103103446-103103468 CTTTAATGATGGAGGGAATAGGG - Intronic
1073462021 10:103671332-103671354 CTTTATTTATAAAACGAAAAGGG + Intronic
1073861069 10:107741288-107741310 CTATATTTATAGAGGGAAAGAGG + Intergenic
1074168877 10:110912849-110912871 ATACATTAATAGAGGGAAAAAGG - Intronic
1074692727 10:116021199-116021221 CTTTATTCATAGTGTGAAAATGG - Intergenic
1075500921 10:122973408-122973430 ATTTATCCACAGAGGGAAAATGG - Intronic
1075506505 10:123027637-123027659 CTTTATCCACAGTGTGAAAATGG + Intronic
1075826259 10:125359245-125359267 CTTTATCCACAGTGTGAAAATGG - Intergenic
1079273344 11:19009760-19009782 TTTTATTCATAGAGGGATGCTGG + Intergenic
1080085352 11:28274264-28274286 CTTTTTTCAGAGATGTAAAAGGG + Intronic
1082181028 11:49119845-49119867 CTTTATCCAAAGAAGGAAAGTGG - Intergenic
1082573823 11:54778010-54778032 ATTGATTCATATAGTGAAAAAGG + Intergenic
1082593211 11:55041051-55041073 ATTTAGTCTTACAGGGAAAAAGG - Intergenic
1085116912 11:73937779-73937801 CATCACTCATATAGGGAAAAAGG - Intergenic
1086428896 11:86716316-86716338 GTTTATACAAAGAGGGAAGAGGG + Intergenic
1086684461 11:89715027-89715049 CTTTATCCAAAGAAGGAAAGTGG + Intronic
1087037059 11:93766353-93766375 CTCTCTTCCCAGAGGGAAAAGGG + Intronic
1087257746 11:95975358-95975380 CTTTTTTAGTAGAGGGGAAAGGG + Intergenic
1088998551 11:115028160-115028182 CTATATTAATAGAGGCAAATAGG + Intergenic
1089577541 11:119456842-119456864 CTTTATTCCAAGTGGGAAAATGG + Intergenic
1091141734 11:133241054-133241076 CTTTATTCATCGAGAGAAAGAGG - Intronic
1091878089 12:3953741-3953763 CCAAATTAATAGAGGGAAAAGGG - Intergenic
1092772099 12:11906109-11906131 CTTTGTTCATAGACTGGAAATGG + Intergenic
1094812688 12:34154686-34154708 CATTATTAATAGAAGAAAAATGG + Intergenic
1095146404 12:38733841-38733863 CTCCATTAATAGTGGGAAAACGG + Intronic
1095829997 12:46574911-46574933 CCTTATTCATATAGTTAAAACGG - Intergenic
1095847363 12:46760023-46760045 CTTTATTAGTAGTGTGAAAAAGG + Intergenic
1096905850 12:54934749-54934771 CTTTCTTCTTAGAAGAAAAATGG - Intergenic
1097377339 12:58856473-58856495 CTTTAATCTGAGAGAGAAAAAGG + Intergenic
1098162685 12:67661032-67661054 CTTTATTTATAAATGGAAACCGG + Exonic
1099070081 12:78035280-78035302 CTTTATCAAATGAGGGAAAATGG - Intronic
1100383125 12:94080519-94080541 CTTTTCTCATATAGGGTAAAGGG - Intergenic
1101033653 12:100684398-100684420 ATGCATTCATAGAGGGTAAAGGG - Intergenic
1101698626 12:107150911-107150933 CTTTATTCCAAAAGGGGAAAAGG + Intergenic
1103877956 12:124143395-124143417 CTTTATTCATAAAAGCCAAAAGG - Intronic
1103942184 12:124507147-124507169 CTGAATTCATAGAGACAAAAAGG + Intronic
1104544386 12:129698500-129698522 CTTTAAACATAAAGGAAAAAAGG + Intronic
1104767091 12:131337090-131337112 TTTAAATCAGAGAGGGAAAAGGG - Intergenic
1106084945 13:26533415-26533437 ATTTCTTAATAGAAGGAAAATGG + Intergenic
1106162680 13:27214952-27214974 TTTAAATCATAGAGGGAGAAGGG - Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106848085 13:33759425-33759447 CTGCATTGATAGAGGGAAATGGG - Intergenic
1106882720 13:34149374-34149396 CTTAATTTCTAGAGGGAAAATGG + Intergenic
1106893045 13:34267111-34267133 CATTATTTATAGATAGAAAAAGG + Intergenic
1106920171 13:34554698-34554720 CTATTTTGATAGAGGAAAAATGG - Intergenic
1107758275 13:43649672-43649694 CTCAATTCATAGAGAAAAAATGG - Intronic
1107897426 13:44979451-44979473 TGCTATTAATAGAGGGAAAAGGG + Intronic
1109020671 13:57087794-57087816 CTTTTTTTATAGAGGCAAATGGG - Intergenic
1109252667 13:60039155-60039177 CATAATTCATAGAGAGTAAAAGG + Intronic
1109259674 13:60129242-60129264 TTTTCCTCATAGAGGCAAAAAGG - Intronic
1110603088 13:77399099-77399121 CTTTATGCCCAGAGAGAAAAAGG - Intergenic
1110755945 13:79174057-79174079 CATTATACAAAGAGGGTAAAAGG + Intergenic
1111663405 13:91238683-91238705 CTTGATTCAGATAGGTAAAAAGG - Intergenic
1112901845 13:104366235-104366257 TTTTATTCAAACAGGGAAATTGG + Intergenic
1112999392 13:105616158-105616180 CTTTATTTATAGAAGGGAAAGGG - Intergenic
1113974364 13:114215038-114215060 TTATATTCCTAGAAGGAAAATGG + Intergenic
1115036363 14:28861533-28861555 CTATATTTATTGAGAGAAAAGGG - Intergenic
1115419340 14:33175497-33175519 TTTTATTCATAGTGTTAAAATGG + Intronic
1116554437 14:46285421-46285443 TTTTATTTATAGAGAGTAAAGGG + Intergenic
1118512111 14:66486825-66486847 CTGGATTCCTAGAGGTAAAAAGG + Intergenic
1118671901 14:68137649-68137671 TTTTATTCATTGGGGCAAAAAGG + Intronic
1119353151 14:73982962-73982984 AAGTATTCATATAGGGAAAAGGG + Intronic
1119956403 14:78802976-78802998 TTTTATTCAAATAGGGAAAGAGG - Intronic
1120366911 14:83582705-83582727 CTTTATTGGTAGTGTGAAAATGG + Intergenic
1120372901 14:83660827-83660849 CATTATTGATAGATGGAAATAGG + Intergenic
1120671629 14:87368798-87368820 CTTTTTTCACATTGGGAAAAGGG + Intergenic
1120965136 14:90160292-90160314 GTTTATTCACAAAGGCAAAAGGG - Intronic
1122317107 14:100832489-100832511 CTGTGTTCATTAAGGGAAAAGGG - Intergenic
1123833380 15:24164516-24164538 CTGTAATCATAGATGGGAAATGG + Intergenic
1123840111 15:24239595-24239617 CTGTAATCATAGATGGGAAATGG + Intergenic
1123853054 15:24380110-24380132 CTGTAATCATAGATGGGAAATGG + Intergenic
1123869011 15:24552678-24552700 CTGTAGTCATAGATGGGAAATGG + Intergenic
1124028818 15:25990665-25990687 CTTTAGTGAGAGAGAGAAAATGG - Intergenic
1126884411 15:53134266-53134288 CTTCATTCTTAGAGGGAAGAGGG + Intergenic
1127338256 15:58012586-58012608 GTTTATTCATACTGTGAAAAAGG - Intronic
1128247064 15:66140380-66140402 CCTTATTCCTGGAGGCAAAATGG + Intronic
1129633932 15:77294021-77294043 CTGCATTCATGGAAGGAAAAAGG + Intronic
1130219976 15:82011255-82011277 GTTTATTCACTGAGGGGAAAGGG - Intergenic
1130700877 15:86179231-86179253 CTTTAGTCATACAAAGAAAATGG - Intronic
1131937901 15:97527185-97527207 CTTTATTCACAGCATGAAAAGGG + Intergenic
1132040225 15:98518893-98518915 CTTTTTTTAGAAAGGGAAAAAGG + Intergenic
1132236133 15:100223035-100223057 CTTTATCAAAAGTGGGAAAATGG - Intronic
1135293223 16:21257957-21257979 CTTAATGCTTAGAGGAAAAATGG - Intronic
1135418598 16:22288698-22288720 CTTTATTTGTAAAGAGAAAATGG - Exonic
1137380075 16:47989978-47990000 CTTTATTAAATGAGGGCAAAGGG + Intergenic
1138848848 16:60602253-60602275 CATTATGTATAGAGGCAAAAAGG + Intergenic
1140276927 16:73517703-73517725 AGTTATTGGTAGAGGGAAAAAGG + Intergenic
1140997383 16:80274386-80274408 CTTTATAAACAGAGAGAAAAGGG - Intergenic
1142819185 17:2451189-2451211 CTTTATTTTCAAAGGGAAAAAGG - Intronic
1143837802 17:9706418-9706440 TTTTAATCTTAGAGTGAAAAAGG - Intronic
1147809773 17:43159880-43159902 CTTCATTTATAAAAGGAAAAGGG - Intergenic
1148800824 17:50224635-50224657 CTTTATTAACAGTGAGAAAATGG - Intergenic
1149037379 17:52149934-52149956 TTTCATGCACAGAGGGAAAATGG + Intronic
1150164645 17:62929977-62929999 CTTGACTGATATAGGGAAAATGG + Intergenic
1151038680 17:70831962-70831984 CTTTATTCAAAGACACAAAACGG - Intergenic
1151090884 17:71439089-71439111 GTGTATTGATAGAGGGGAAAAGG - Intergenic
1151998753 17:77631376-77631398 CTTTATATTAAGAGGGAAAAAGG + Intergenic
1153783953 18:8517724-8517746 CTTCATTCATGGAAGGAAAGTGG + Intergenic
1154926739 18:20943406-20943428 CTTTATTAACAGGGTGAAAATGG + Intergenic
1155126688 18:22885063-22885085 CTTTAATCTTAGAGAAAAAATGG - Intronic
1155915073 18:31549529-31549551 CCGTATTCATAGACAGAAAATGG + Intergenic
1155967983 18:32053833-32053855 CTTTATTCTTAATGGGATAAGGG + Intronic
1156744194 18:40369466-40369488 CTCTATTCACAGGAGGAAAAAGG + Intergenic
1156789944 18:40959206-40959228 CTTTATTCATATAGACAGAAAGG - Intergenic
1157939217 18:51908678-51908700 CTGTACTCAAAGAGTGAAAATGG + Intergenic
1158743554 18:60170320-60170342 ATTTATTCTTTAAGGGAAAAAGG + Intergenic
1159286996 18:66366722-66366744 CTTTATTAACAGAGTGAGAATGG + Intergenic
1159402985 18:67961155-67961177 ATTTATTCAGAGAGGAAGAAAGG + Intergenic
1159969608 18:74633240-74633262 CTTTATTCATTGAGCAAAGAAGG + Exonic
1160764807 19:802726-802748 GTTTATTCAAAGAGTGAAATTGG - Intronic
1163539860 19:17901590-17901612 CTTTATTAGTAGCGTGAAAATGG + Intergenic
1164901612 19:31930936-31930958 CTTTATCCACAGTGTGAAAACGG - Intergenic
1164949795 19:32327546-32327568 CTTTAATAAAAGAGGAAAAAGGG - Intergenic
1166917357 19:46204408-46204430 CTCTTTACATAGAGGGAATAGGG + Intergenic
925517718 2:4703380-4703402 CTTTATTCATATAGAAAACAAGG - Intergenic
927605790 2:24485047-24485069 CTTTATTAGCAGAGTGAAAACGG + Intergenic
928190799 2:29165403-29165425 CTTTCCTCATTGAGGGAACATGG - Intronic
929010952 2:37443593-37443615 CTTCATTCATAGAGATAAATGGG + Intergenic
929035524 2:37688005-37688027 CTTTATTAACAGCGTGAAAATGG - Intronic
929338856 2:40787549-40787571 CTTTCTTAATAGAGGGCACATGG + Intergenic
929696064 2:44116539-44116561 ATGCAGTCATAGAGGGAAAATGG + Intergenic
930214013 2:48674040-48674062 CATTATTCATAGCAGCAAAAAGG - Intronic
930295888 2:49553226-49553248 CTTTATTCTTAGCATGAAAATGG - Intergenic
930639394 2:53839865-53839887 GTTTATTCAGAGTGAGAAAAAGG - Intergenic
931229130 2:60359230-60359252 CATTATTCCAAGAGAGAAAAAGG + Intergenic
932362728 2:71122425-71122447 CTTTATCAATAGCGTGAAAATGG - Intronic
932393379 2:71417582-71417604 CCTTATTCATAAAGGAATAACGG - Intronic
933242457 2:79937682-79937704 CCTTTTTAATAGAGGGAACAGGG - Intronic
933674118 2:85038328-85038350 CTTTATTTATATTGGCAAAATGG + Intronic
933866856 2:86527362-86527384 CTTTATTCATAGAGGGAAAAAGG + Intronic
933868081 2:86542713-86542735 CATTATTTTTAAAGGGAAAAAGG - Intronic
934099535 2:88640276-88640298 CTTTTTAAATGGAGGGAAAATGG + Intergenic
934332628 2:92085116-92085138 CTTTATTCTTATGGTGAAAAAGG + Intergenic
935347463 2:102121685-102121707 CTTTGTTGAGAGAGAGAAAATGG - Intronic
937030786 2:118738548-118738570 CTTTATTAATAAATGGAAAGTGG + Intergenic
937979803 2:127608344-127608366 CTTTATTCAAAGGGCAAAAAGGG - Intronic
938234762 2:129696750-129696772 CTTTATTTGCAGAGTGAAAATGG + Intergenic
939129754 2:138220680-138220702 CTTTATTCACACAGGTTAAAAGG + Intergenic
939950397 2:148465311-148465333 CATTAATCATAAAGGGAAAAGGG - Intronic
940035607 2:149309645-149309667 CATTCTTCAGAAAGGGAAAAGGG - Intergenic
940136079 2:150436943-150436965 CTTTATTGACAGCGTGAAAACGG + Intergenic
941051016 2:160734313-160734335 GTTAATTAATAGAGGGAGAAGGG - Intergenic
941226721 2:162858658-162858680 CTTTGTTCACAGAGGGAGACAGG + Intergenic
941920294 2:170843704-170843726 CTATAATCTTAGAGGTAAAAGGG + Intronic
942596739 2:177598809-177598831 CTCTTTTCACAGATGGAAAAAGG + Intergenic
942778673 2:179614838-179614860 CTTTTATTATAGAGGGTAAATGG + Intronic
943366251 2:186970135-186970157 CTTTTTGTCTAGAGGGAAAAGGG - Intergenic
943543404 2:189244812-189244834 CTTTATTGGCAGAGTGAAAATGG - Intergenic
944430644 2:199629959-199629981 TTTTATTCACAGAAGAAAAAAGG + Intergenic
945127076 2:206524494-206524516 CTTTATTAGCAGAGTGAAAATGG - Intronic
945516333 2:210767308-210767330 ATTTATTTATAGAGGATAAAAGG - Intergenic
946973552 2:225122371-225122393 CTTTTTTAATTGAGGGAGAATGG - Intergenic
947631943 2:231659513-231659535 CTTTATAAATACAGTGAAAACGG + Intergenic
948220246 2:236263667-236263689 CATTATTTATAGAAGCAAAAAGG + Intronic
948321656 2:237074491-237074513 CTTGAGTCATAGAAGGCAAAAGG + Intergenic
1170005657 20:11666174-11666196 AATGATTCTTAGAGGGAAAAAGG + Intergenic
1171270622 20:23814043-23814065 CTTAAATCAGAGAGGGACAAAGG - Intergenic
1171336796 20:24392613-24392635 TTTTACTCATAGAAGGCAAATGG + Intergenic
1173239388 20:41280338-41280360 CAGTATTTATAGAGGGAAGAGGG + Intronic
1176516231 21:7785700-7785722 CTTTCTTCATGGTGGCAAAATGG + Intergenic
1177124417 21:17178187-17178209 CTTTCTTCAGAGAGGTAATATGG - Intergenic
1178650259 21:34415712-34415734 CTTTCTTCATGGTGGCAAAATGG + Intergenic
1179029767 21:37710693-37710715 TGTTATTTATAGAGGGCAAATGG - Intronic
1182059542 22:27387403-27387425 CTTTTTTCCTAAATGGAAAATGG - Intergenic
1183022386 22:35037844-35037866 CTTTATTATTAGTGTGAAAACGG - Intergenic
1183487306 22:38095848-38095870 CTAAATTAATAAAGGGAAAAGGG + Intronic
1202727047 2_KI270716v1_random:11724-11746 CTTTATTCTTATGGTGAAAAAGG + Intergenic
949337894 3:2996184-2996206 ATATATTCATGGGGGGAAAAAGG + Intronic
949734151 3:7151684-7151706 CTTTTTTCCTAAAGGGCAAAGGG - Intronic
949913354 3:8934784-8934806 CATTATTAATAGAGGAAAAGTGG + Intronic
953622973 3:44548684-44548706 CTTAAATCAGAGAGGGAGAAGGG + Intergenic
954713212 3:52514974-52514996 CATTTCTCCTAGAGGGAAAAAGG - Exonic
954831301 3:53423521-53423543 CATTGTACAGAGAGGGAAAAAGG - Intergenic
956220899 3:66902057-66902079 CTTTATTAGCAGGGGGAAAATGG + Intergenic
956931949 3:74053463-74053485 CTGGAGTCATAGAGAGAAAATGG + Intergenic
957004655 3:74930884-74930906 CATTGTTCATATATGGAAAATGG - Intergenic
957944500 3:87045514-87045536 CTTTCTTCAGCCAGGGAAAAGGG + Intergenic
958601360 3:96300012-96300034 CTTAAGTCAGAGAGGGAGAAAGG - Intergenic
958773563 3:98455001-98455023 CTTTATTTCTGGAGGGAACATGG - Intergenic
960257623 3:115527685-115527707 CTTTATTAGTAGTGTGAAAATGG + Intergenic
960814084 3:121655650-121655672 CTTTATTCAGAAAAGGAAAAGGG + Intronic
961174802 3:124825886-124825908 TTTTATTAATAGTGAGAAAAAGG + Intronic
963143672 3:141970250-141970272 CTTTATTCATATTGTTAAAATGG - Intronic
964064465 3:152562047-152562069 CTTAAATCAGAGAGGGAGAAGGG - Intergenic
964895364 3:161589707-161589729 CTTTATTAGTAGAGTGAGAATGG - Intergenic
964939784 3:162143802-162143824 CTTTATTTAAAGAGGGAGGAAGG - Intergenic
964969817 3:162545727-162545749 CTTTATTAATAGTGGGTAGAAGG - Intergenic
964991735 3:162821026-162821048 CTTTATTCAGAGACAGCAAAGGG + Intergenic
966148272 3:176836782-176836804 CTTTATCCACAGTGTGAAAATGG + Intergenic
967491706 3:190099694-190099716 CTTTATTCATAGAAAAAAGATGG + Intronic
967635316 3:191794735-191794757 CTAGATTCATTTAGGGAAAATGG - Intergenic
967654346 3:192028596-192028618 CCTTATTTATAGAGGAAAAAAGG + Intergenic
970461950 4:16283479-16283501 CTTTATCCACAGTGTGAAAACGG + Intergenic
970504681 4:16715586-16715608 TTTTATTAACAGAGGAAAAATGG - Intronic
971509015 4:27400744-27400766 TTTTAATCATAAAGGGATAATGG - Intergenic
971949892 4:33331777-33331799 CTTTATTTCAAGAGGGAAAATGG + Intergenic
972841987 4:42941889-42941911 TTTTTTTTAAAGAGGGAAAATGG - Intronic
973817998 4:54636197-54636219 CTTTATTCTGATAGAGAAAACGG + Intergenic
974382207 4:61155326-61155348 CTTTATTTAACGAGGTAAAATGG - Intergenic
974960222 4:68689970-68689992 ATTTTTTCATAATGGGAAAAAGG + Intergenic
975554153 4:75643581-75643603 CCTCATTCAAAGGGGGAAAAAGG + Exonic
976577424 4:86690194-86690216 CTCTAGTTAAAGAGGGAAAATGG - Intronic
976774458 4:88692306-88692328 CTTTTTTAATATGGGGAAAATGG - Intronic
978067046 4:104417983-104418005 CTTTATTGCTATATGGAAAATGG - Intergenic
978747139 4:112207685-112207707 TTTAATTCAGAGAGGGAGAAGGG - Intergenic
979177032 4:117678411-117678433 CTTTATTAGCAGTGGGAAAATGG + Intergenic
979184109 4:117766520-117766542 CTGTATTCACAGACAGAAAAAGG - Intergenic
980018035 4:127676123-127676145 CTTTTTACATGGAGGGATAATGG + Intronic
980210381 4:129779753-129779775 TCTTAATCAAAGAGGGAAAAGGG + Intergenic
980294649 4:130895992-130896014 CGGTATTTATAGACGGAAAAAGG - Intergenic
980617223 4:135244849-135244871 CTGTGTTCTTAGAGGGACAAGGG - Intergenic
980789670 4:137603746-137603768 CTTGATCAATAGAGTGAAAATGG + Intergenic
981740300 4:147994664-147994686 CTTTATTCGTAGATTGAAAATGG + Intronic
981974294 4:150705217-150705239 CTTTATTAATAAAAGCAAAATGG - Intronic
982133912 4:152256017-152256039 TTTTACTCATAGAGGAAAAGAGG - Intergenic
982519064 4:156390349-156390371 CTTTTTTCAGAGAGATAAAAGGG + Intergenic
984496609 4:180505999-180506021 CTTTATGTGTAGATGGAAAAGGG - Intergenic
984833312 4:183996500-183996522 ATTTATTCAAAGAAGAAAAAAGG - Intronic
985003471 4:185508723-185508745 ATTTATTTATAAAGGGAAGACGG + Intronic
986085788 5:4444333-4444355 CTTTATTAATAGGGGAAACATGG + Intergenic
986274781 5:6264078-6264100 CTTTATTAACAGAGTGAGAATGG + Intergenic
986874418 5:12090388-12090410 TTTTATAAATAGAGGTAAAAGGG - Intergenic
987414799 5:17651585-17651607 GTTTTTTCAAAGAGGAAAAATGG + Intergenic
987545286 5:19305085-19305107 CTTAAATCAGAGAGGGAGAAGGG + Intergenic
988031138 5:25764248-25764270 CTTTATTAAGAGACAGAAAAAGG + Intergenic
988875639 5:35443221-35443243 ATTTATCCATTGAGGGATAATGG - Intergenic
988950364 5:36252165-36252187 CCTCATTCATAAAGGGAAGAGGG - Intronic
990188310 5:53231079-53231101 TTTAAATCAGAGAGGGAAAAGGG + Intergenic
991122278 5:63030505-63030527 CTTCATTGATGGAGGGAAGAAGG - Intergenic
991277411 5:64865626-64865648 CCTTATTTTTAGAGGGAAGATGG + Intronic
991510671 5:67373519-67373541 CTTTATTTATTGATGGAAAGAGG - Intergenic
992488023 5:77214378-77214400 CTGTATGAATGGAGGGAAAACGG - Intronic
992586514 5:78245562-78245584 CTTTCTTCATGTTGGGAAAAGGG - Intronic
993113727 5:83692397-83692419 CATTATTCACAGAGGAATAAAGG + Intronic
994089255 5:95794500-95794522 CTTGTTACATAGAGGGAAAATGG + Exonic
994520834 5:100832828-100832850 CTTGACACATAGAGGGAAAGAGG - Intronic
994568180 5:101481423-101481445 CTATGTTTATAGAGAGAAAATGG + Intergenic
995591340 5:113703192-113703214 CCTTTTTCTTAGAGGGCAAAAGG - Intergenic
997504473 5:134405737-134405759 TTTTATCCCAAGAGGGAAAATGG - Intronic
998273911 5:140733447-140733469 TTTATTTCACAGAGGGAAAAAGG - Intergenic
998925337 5:147117608-147117630 ATTTATTCATTGATGGAAATAGG + Intergenic
999448706 5:151662601-151662623 CTTGATTAATAGAAGAAAAAAGG + Exonic
999605603 5:153311180-153311202 CTTCATTAAGAGAGGAAAAATGG - Intergenic
1000912153 5:167035673-167035695 TTGTATTCAAAGTGGGAAAAGGG + Intergenic
1001203364 5:169739301-169739323 CTGTAATTGTAGAGGGAAAATGG + Intronic
1001753587 5:174149680-174149702 CTCTGTTCAGAGAGGGACAAGGG + Intronic
1003458413 6:6306526-6306548 CATCATTCATAGAGGGGAAGGGG - Intronic
1003913804 6:10766726-10766748 GCTTATTCAGGGAGGGAAAAGGG + Intronic
1004227643 6:13801521-13801543 CTTTATTCCAAAAGGGGAAAAGG + Intronic
1004695633 6:18030238-18030260 CTTTAATCATAAGGGGGAAAGGG - Intergenic
1006252466 6:32799415-32799437 CAATATTTATAGAGAGAAAAAGG + Intergenic
1008801831 6:55377999-55378021 CTTTATTCATAGGAGAAGAAAGG + Intronic
1009357949 6:62775568-62775590 CTTTATGCTGACAGGGAAAATGG - Intergenic
1009490620 6:64285629-64285651 TTTTATTAATAGTGTGAAAATGG - Intronic
1010640109 6:78315073-78315095 CTTTATACATAGATTCAAAATGG + Intergenic
1011029094 6:82901800-82901822 CTTTATTAATATTGGGAAATAGG - Intronic
1012397139 6:98811460-98811482 CTTGAATCATATAGGGAAGATGG - Intergenic
1012447784 6:99324228-99324250 CTTTTTTTAAAAAGGGAAAAAGG - Intronic
1012745531 6:103082483-103082505 CAGTATTTATAGATGGAAAAGGG - Intergenic
1013563869 6:111335600-111335622 CTTTTTTAACAGATGGAAAATGG - Exonic
1014000488 6:116360523-116360545 CTCTATTTAAAGAGGGATAATGG - Intronic
1015015105 6:128403331-128403353 CCTTATTCATAGATGTATAAGGG - Intronic
1015701013 6:136036233-136036255 CTCTTATCAGAGAGGGAAAAAGG + Intronic
1015712805 6:136160592-136160614 CTGTCTTCATAGTGGAAAAAGGG - Intronic
1016157003 6:140823194-140823216 ATATATTAATAGAGGGAAGAGGG - Intergenic
1016509260 6:144822322-144822344 CATTACCTATAGAGGGAAAAAGG - Intronic
1016538956 6:145141377-145141399 CTTTCTTCCTAAAGGGAAATTGG + Intergenic
1016585697 6:145682037-145682059 CTTTATTAGCAGAGTGAAAACGG - Intronic
1016840908 6:148524629-148524651 CTTCATTCACTGAGAGAAAAGGG + Intronic
1017546460 6:155456548-155456570 CTTTTTTGAAAGAGGGGAAAAGG - Intergenic
1020192898 7:6014050-6014072 ATTTATACAAATAGGGAAAAGGG - Intronic
1020332077 7:7028990-7029012 TTTTAATCATAGAGGGATGATGG + Intergenic
1020708282 7:11572840-11572862 CATTATTGACGGAGGGAAAAAGG - Intronic
1020732154 7:11893732-11893754 TTTTAATCCTAGAGGGCAAAGGG - Intergenic
1020744877 7:12068399-12068421 CTTTAGTTGTAGAGGGAAAAGGG - Intergenic
1021678823 7:23108309-23108331 TTCTATACATAGAGGCAAAAGGG + Intronic
1022349405 7:29553549-29553571 CTTTATTCGTAGTGTGAGAATGG - Intergenic
1023065375 7:36372520-36372542 CTATTTTCATTGAGGTAAAAAGG - Intronic
1024273153 7:47657448-47657470 CGCTATTCATAGATGGGAAAAGG - Intronic
1024608298 7:51040768-51040790 CTTTATGCAAACAGGGAATATGG - Intronic
1024934929 7:54702266-54702288 CTTTATTCGTAGAGGCCAGATGG + Intergenic
1024967019 7:55032830-55032852 CTTGACTCAGAGAGGGAAAAGGG + Intronic
1025832126 7:65061455-65061477 CTTCATTCACAGAGGGGAAAAGG - Intergenic
1025919806 7:65900883-65900905 CTTCATTCACAGAGGGGAAAAGG - Intronic
1026358794 7:69583751-69583773 CCTTATTATTAGAGCGAAAAAGG + Intergenic
1027142295 7:75667267-75667289 CTTGATTCATGGAGTGATAATGG + Intronic
1027939532 7:84656982-84657004 CTTTATTCAGAAAGAGGAAAGGG - Intergenic
1027996915 7:85435690-85435712 CTTTATCAGCAGAGGGAAAATGG + Intergenic
1028000492 7:85491700-85491722 ATTTATTCAGAAAAGGAAAAAGG - Intergenic
1028474078 7:91234721-91234743 TTTTATTAATGGAGGGAAATTGG - Intergenic
1029176276 7:98666975-98666997 CTCAATTCTTATAGGGAAAATGG - Intergenic
1029268912 7:99364654-99364676 ATTTATTCATTGAGGAAAAATGG + Intronic
1030578901 7:111327186-111327208 TTTAATTCATAAAGGCAAAAAGG + Intronic
1031611645 7:123834777-123834799 TTTTAATCATAAAGGGACAATGG + Intronic
1032479884 7:132237754-132237776 CTTGTTTCAAAGAGGGAGAACGG - Intronic
1032503658 7:132419134-132419156 ATTCATTCCCAGAGGGAAAATGG + Intronic
1033007589 7:137584302-137584324 ATTCAATCATAGAAGGAAAATGG + Intronic
1033978809 7:147138184-147138206 CTGTATTCTTAGGGCGAAAATGG + Intronic
1034141222 7:148819060-148819082 CTTGGTTCAAAGAGGGGAAATGG + Intronic
1035855146 8:2966450-2966472 TTTAATTCATAGAGGAAAAAAGG - Intronic
1036179612 8:6572959-6572981 CTTTCTTCAGGGAGGGAGAAAGG - Intronic
1036444476 8:8809634-8809656 CTTTATCCAGAGCAGGAAAAGGG - Intronic
1036726860 8:11228408-11228430 CTTATTTCACAGAGGAAAAAAGG - Intergenic
1038401696 8:27288897-27288919 CCTTCTTCAGAGAGGGAAACTGG - Intronic
1038477603 8:27879076-27879098 CTTTTTTCAAGGAGGGAAACAGG - Intronic
1039201990 8:35105236-35105258 CTGTATTCATTGAGGAAAACAGG + Intergenic
1040741501 8:50580806-50580828 CTTTATCAATAGAGTGAGAATGG + Intronic
1041282157 8:56221321-56221343 CTTTTTTCATAGAGTGTTAATGG + Intergenic
1043023189 8:75031245-75031267 ATTTATTCATACAAGAAAAAAGG - Intronic
1043065543 8:75566212-75566234 CCTTATACATAAAAGGAAAAAGG + Exonic
1043389918 8:79782774-79782796 CATTATTCATAGTGGCCAAAAGG + Intergenic
1044213778 8:89582943-89582965 CTTCAGTCATAGAGGACAAATGG + Intergenic
1044594096 8:93941605-93941627 GTCTATTCTTAGAGGCAAAAAGG - Intergenic
1045881251 8:107043530-107043552 TTTTAATCATAGAGGGATACTGG - Intergenic
1046510026 8:115190804-115190826 CATTATTAATAGAGAGATAATGG + Intergenic
1046881997 8:119319548-119319570 CTTTATTAACAGGGTGAAAATGG - Intergenic
1047624825 8:126645971-126645993 TTTTATACATGGAAGGAAAATGG - Intergenic
1047815874 8:128461689-128461711 ATTTATTAATAAAGGGACAAAGG + Intergenic
1048075061 8:131061204-131061226 CCTTTTTCATAGAGTGTAAATGG - Intergenic
1048482933 8:134817889-134817911 GATTATTCACAGGGGGAAAAGGG + Intergenic
1048641585 8:136369606-136369628 GTTAATTCATAGTGGGATAAAGG + Intergenic
1049723670 8:144134854-144134876 CATTATTCATAGTGGTCAAAAGG - Intergenic
1050119238 9:2291282-2291304 ATATATCCACAGAGGGAAAAGGG - Intergenic
1050405989 9:5309177-5309199 CTTTGTTCCTAGAGGGACAGAGG + Intergenic
1050455061 9:5826807-5826829 CTTTATTCAAAAAGAGAGAAAGG + Intronic
1050967714 9:11828627-11828649 ATTTATTTTTAGAGAGAAAAAGG + Intergenic
1051126218 9:13808797-13808819 GTTTATGCAGAAAGGGAAAATGG + Intergenic
1052051496 9:23853440-23853462 CTTTATTTAGTCAGGGAAAATGG + Intergenic
1052295578 9:26893379-26893401 CTTTAGCCACTGAGGGAAAAAGG + Intergenic
1052626950 9:30987770-30987792 CTTTATTCAGAGAGTAAAGATGG - Intergenic
1052914635 9:33915284-33915306 ATTTATTCAGAGAAGTAAAATGG + Intronic
1053360403 9:37482572-37482594 CATTTTTCAGAGAAGGAAAATGG - Intergenic
1056884296 9:90425815-90425837 GTTTAAGTATAGAGGGAAAATGG - Intergenic
1057239740 9:93398389-93398411 CTTTATTCGCAGCGGGAGAATGG + Intergenic
1059113589 9:111580072-111580094 CTATAGTCTTAGAAGGAAAAAGG - Intronic
1059280576 9:113130018-113130040 CTTGATTCTAAGAGGGGAAAGGG + Intergenic
1059850746 9:118336389-118336411 GTTTAGTAATAGAGGGCAAAAGG - Intergenic
1060407616 9:123380709-123380731 TTTGATTTATAGAAGGAAAATGG - Exonic
1186203441 X:7176977-7176999 TTATTTTCATAGAGGCAAAATGG - Intergenic
1186252077 X:7679145-7679167 ATTTAGTCAAAGAGAGAAAAGGG - Intergenic
1186588090 X:10898115-10898137 CTATTTTCAAAAAGGGAAAAGGG + Intergenic
1186631066 X:11349401-11349423 CTTTATTTCTAGAGGGCCAAAGG - Intronic
1186975415 X:14897164-14897186 CGTTATGCTAAGAGGGAAAATGG + Exonic
1187140483 X:16588431-16588453 CTTTAGTCATACAAAGAAAATGG - Exonic
1188118041 X:26268966-26268988 TTTTAGTCAGAGGGGGAAAATGG - Intergenic
1188512120 X:30947633-30947655 CTTTTTTCACGAAGGGAAAATGG - Intronic
1189512050 X:41672479-41672501 CTTTAGTCATAGAAGACAAAAGG + Intronic
1189985409 X:46549172-46549194 CTTGAGACACAGAGGGAAAAAGG - Intergenic
1192017647 X:67348865-67348887 ATTTTTTCATGGAGGCAAAATGG - Intergenic
1192317562 X:70064781-70064803 CTTTATTCTTAGAGATATAAAGG + Intergenic
1192670345 X:73133433-73133455 CTTTATGCATAGAGGTCAAGAGG + Intergenic
1192910168 X:75595373-75595395 CTTTATTCATAGTAGCTAAAAGG + Intergenic
1195483739 X:105378320-105378342 CATTCTTCATAAAGTGAAAATGG - Intronic
1196483781 X:116180920-116180942 CTTTATTAGCAGAGTGAAAATGG + Intergenic
1197513346 X:127397251-127397273 TTTAAATCATAGAGGGAGAAGGG - Intergenic
1198607465 X:138357205-138357227 CTATACTGAAAGAGGGAAAAGGG - Intergenic
1199354831 X:146849908-146849930 CTTCATCCTTTGAGGGAAAAGGG - Intergenic
1199449706 X:147965781-147965803 CTTTATTCTTAGAATGAAATTGG - Intergenic
1200610319 Y:5320854-5320876 ATTAAATCATAAAGGGAAAAGGG - Intronic
1201467922 Y:14305127-14305149 ATTTAGTCAAAGAAGGAAAAGGG - Intergenic
1201609566 Y:15825593-15825615 CTTCATTCTTAGAGGGAGTATGG - Intergenic
1202089923 Y:21178780-21178802 CTTAAATCAGAGAGGGAGAAGGG + Intergenic