ID: 933875826

View in Genome Browser
Species Human (GRCh38)
Location 2:86621342-86621364
Sequence CCAAAGCCATCATTTTTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 296}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933875826 Original CRISPR CCAAAGCCATCATTTTTTTA TGG (reversed) Intronic
902266491 1:15270739-15270761 CCAAAGTCTTCATCTTTTAAGGG - Intronic
905113012 1:35611308-35611330 CAAAAACCATGAGTTTTTTAAGG - Intronic
906349538 1:45046120-45046142 CCAAAGTCATCTTTTTCTCATGG - Intronic
909427848 1:75547941-75547963 CCAGAACCCTCAGTTTTTTAGGG + Intronic
909618682 1:77642949-77642971 CCAAAGTGTTAATTTTTTTATGG - Intronic
912342361 1:108929257-108929279 CCTAAGACGTGATTTTTTTAAGG + Intronic
915133092 1:153709887-153709909 CCCATGATATCATTTTTTTATGG + Intergenic
916238805 1:162617927-162617949 CCCAAGCTATCATGTTTTTGAGG + Intergenic
917021071 1:170587749-170587771 AAAAAGCAAGCATTTTTTTAGGG - Intergenic
919363117 1:196620457-196620479 CCTAGGCCATGATTTTTTGATGG + Intergenic
920409965 1:205751382-205751404 TCAAAGCGATCATTTTTGTTTGG + Intergenic
921342957 1:214152965-214152987 CCACATCCATCCTTATTTTAGGG + Intergenic
922967514 1:229703410-229703432 CCAAATCCATACTATTTTTATGG - Intergenic
923832692 1:237575405-237575427 TTAAAGCCATGATTTTTATATGG + Intronic
924223861 1:241904895-241904917 CCCAGGCTCTCATTTTTTTAAGG - Intergenic
924634934 1:245777073-245777095 CCATTACGATCATTTTTTTAAGG - Intronic
1063400098 10:5735273-5735295 GAAAAGACATCATTTTTGTAAGG - Intronic
1064623230 10:17235949-17235971 TCAAAGCATTCATTTTTTTTAGG + Intronic
1067915380 10:50392347-50392369 TCAAAGCCATGGTTTCTTTATGG + Intronic
1068540162 10:58283436-58283458 CCAAAGCAAGCATATTTTTCTGG + Intronic
1068640816 10:59404804-59404826 CCAAAGCCAGCTTCTGTTTATGG - Intergenic
1068957626 10:62833488-62833510 TCTTACCCATCATTTTTTTATGG - Intronic
1069023879 10:63520338-63520360 CAAAAGCCATCATATTTTCTAGG + Intergenic
1069447687 10:68488794-68488816 CCAAAGCTATAATTTTTTATTGG - Intronic
1069970483 10:72163738-72163760 CCAGAGCCAAAATTTTTTTTTGG - Intronic
1070943308 10:80366472-80366494 CAAAACCCATCATCTTTTCATGG - Intronic
1073429163 10:103475135-103475157 CCAAAGCCATAGTCTCTTTAAGG + Intronic
1074522572 10:114239197-114239219 CCAAAGTCAACATTTTTTCAAGG + Intergenic
1074913080 10:117929499-117929521 TCCAAGCCATGATTTTTTTCTGG - Intergenic
1075176240 10:120163900-120163922 CCAGAGCAATCAATTTTTAATGG - Intergenic
1075217662 10:120552502-120552524 CCCAAGACATTATTTTTTGATGG - Intronic
1078745398 11:14109066-14109088 CCTAAACCATCACTTCTTTAAGG + Intronic
1079543312 11:21602351-21602373 CCAAAGCTGTCATTTATTTTGGG - Intergenic
1079902423 11:26204063-26204085 CAAATGCCATCTTTTTCTTATGG + Intergenic
1080425800 11:32153161-32153183 ACAAAGCTATCATTCTTTTGAGG + Intergenic
1082171211 11:49007705-49007727 CCAAACTCATCTTTTTTTTATGG + Intergenic
1082712826 11:56575524-56575546 CCAAAGAGATCATTTATTAAAGG - Intergenic
1083170044 11:60918438-60918460 CCAAAGTCATCCTTTTTATCAGG + Intronic
1084838816 11:71828251-71828273 CAAAGGACATAATTTTTTTATGG - Intergenic
1085980279 11:81716476-81716498 CCAAATTCATCATTTTCCTAGGG - Intergenic
1087569739 11:99910269-99910291 CAAAAACCTTCATTTTTCTATGG + Intronic
1088236028 11:107723935-107723957 CCAATTTCATGATTTTTTTATGG + Intergenic
1089033535 11:115359666-115359688 CCAAAGAAAGCTTTTTTTTAAGG + Intronic
1089654215 11:119935300-119935322 CCAAAGCCAGCATGATTTTAGGG + Intergenic
1090552916 11:127842347-127842369 CCGATGCCAAAATTTTTTTAAGG + Intergenic
1090561265 11:127935361-127935383 CCAAAGTCTACATTTTTGTAAGG + Intergenic
1090910721 11:131117084-131117106 CTGAAGTCATCCTTTTTTTATGG - Intergenic
1091501186 12:1019552-1019574 CCAATGACATCATCCTTTTATGG + Intronic
1091853440 12:3719524-3719546 CCAAATCAATGATTTGTTTAAGG + Intronic
1091960067 12:4686335-4686357 CCAAACCCATCTTGTTTATAGGG - Intronic
1095426634 12:42081486-42081508 CCAAAGCAATCACTTTTCAAAGG - Intergenic
1095724987 12:45441849-45441871 CCAAAGCCTGTATTTCTTTAGGG - Intergenic
1096063097 12:48718433-48718455 GCAATGCCTTCATTTTTGTATGG + Intergenic
1097670568 12:62532067-62532089 CCAATGGCATCTTATTTTTAAGG + Intronic
1098929781 12:76397740-76397762 CAAAAGCCATCCTTTTTTGATGG + Exonic
1099388307 12:82046706-82046728 CGAATGCCATTATTTTATTATGG - Intergenic
1099568967 12:84289330-84289352 CAGAAGCCATTATTTTTTAATGG - Intergenic
1100003778 12:89868925-89868947 TCAAAGCCATCAGACTTTTATGG - Intergenic
1101237273 12:102802403-102802425 CCAAAGCCATCATTTTCCTCTGG + Intergenic
1102399956 12:112620222-112620244 CCTAAGCCAACATGTTTTCATGG + Intronic
1102683986 12:114710101-114710123 CCAAAGCCTTCATCAATTTAGGG + Intergenic
1103922412 12:124405783-124405805 CCAAAGCCTTCTATGTTTTAGGG + Intronic
1104111235 12:125706656-125706678 CCAAAGCTAAAATTTCTTTAAGG + Intergenic
1104883630 12:132090250-132090272 CAAAAGCCAACAGGTTTTTATGG - Intronic
1105796474 13:23859040-23859062 GCCAAGCTATCAATTTTTTAAGG - Intronic
1106727155 13:32497708-32497730 GCAAAGCCATAATATTTGTATGG - Intronic
1106777063 13:33018504-33018526 ACAAATCCAACATTCTTTTATGG - Intronic
1106868271 13:33990961-33990983 CTGAAGCCATCTTTTCTTTATGG - Intergenic
1107254293 13:38405147-38405169 CTGAAGCCATCATTTTGTTCTGG + Intergenic
1109170365 13:59088721-59088743 CCAAGGCCTCCATTTTTTTCTGG - Intergenic
1110034098 13:70656904-70656926 CCAAAATCAGCATTTATTTAAGG + Intergenic
1110437033 13:75486590-75486612 CCAAAACCACCTTTTTTTTTTGG - Intergenic
1110670017 13:78166972-78166994 CTTAAGCCATCATCTTTCTAAGG + Intergenic
1110696981 13:78502460-78502482 CTAAAGCCATCTTTTTATCATGG + Intergenic
1110839981 13:80130793-80130815 CCCAAGCCATTATTGTTGTAAGG + Intergenic
1111555409 13:89874951-89874973 CCAAATGCATAATATTTTTATGG + Intergenic
1111946160 13:94667997-94668019 CCAAAGCCATCAGTTATCTGGGG + Intergenic
1111999895 13:95200388-95200410 CCAAAGACAGCATATTTTCAGGG + Intronic
1112494013 13:99891583-99891605 GAAAAGCGTTCATTTTTTTAGGG - Exonic
1112596071 13:100808398-100808420 CAAAAGCTATCATTTCTTTAGGG - Intergenic
1113898757 13:113784082-113784104 CCAAAGCGTTTAGTTTTTTATGG - Intronic
1113989240 13:114346682-114346704 TGAAAAACATCATTTTTTTATGG - Intergenic
1114833931 14:26180515-26180537 CCAGAGCCATCATTTTGTTTAGG + Intergenic
1115750567 14:36485630-36485652 ATTAAGCCATCATTTTGTTAAGG + Intronic
1115881108 14:37920369-37920391 ATAAACTCATCATTTTTTTATGG + Intronic
1116225848 14:42151495-42151517 ACAAACTCATCATTTTTTTATGG + Intergenic
1116785420 14:49282385-49282407 CTAAAACCATTATTTTTTTGTGG + Intergenic
1117242591 14:53849866-53849888 AGAAAGTCATCATTTTTTGACGG - Intergenic
1117817067 14:59609460-59609482 CAAAAGCCATAATCTTTTTCAGG + Intronic
1120242495 14:81965731-81965753 CCAAAGCCAGAATTCTCTTAGGG - Intergenic
1121839369 14:97119962-97119984 CCAAAGCCAGCATGTATTCAAGG - Intergenic
1122396107 14:101433183-101433205 CCAATGCCATCATCTTTGGATGG - Intergenic
1122606717 14:102951491-102951513 CCCAGCCCATCATATTTTTAAGG - Intronic
1123881705 15:24682741-24682763 CCAAAAACATTTTTTTTTTATGG - Exonic
1124216432 15:27811187-27811209 CAAAAGACATTTTTTTTTTACGG - Intronic
1124392749 15:29274442-29274464 CCAAAGCCCTTACTTTTTCAAGG - Intronic
1124796467 15:32785816-32785838 CCAAAGCCATTAACTTTTAATGG - Intronic
1124916486 15:33979617-33979639 CCAAATCTTTCATTTTTTAAAGG - Intronic
1125023368 15:35006609-35006631 CCAAATTCATAATTTTTTTCAGG - Intergenic
1126290375 15:47069680-47069702 CCAAATCCTTCCTTATTTTAAGG - Intergenic
1126584393 15:50268646-50268668 CCAATGCCCTTATTTTCTTAGGG - Intergenic
1127385899 15:58466670-58466692 ACAAAGCCATTATGTGTTTAGGG - Intronic
1127544162 15:59974692-59974714 CCAAGGCCATCAGTTTTAAACGG + Intergenic
1128998618 15:72315548-72315570 CCAAAGCCATAATTTTACCAAGG + Intronic
1130572736 15:85062929-85062951 CCAAAGCCAGAATTTTTATGAGG - Intronic
1130924733 15:88376415-88376437 CCAAATCCATCATTTTACCAAGG - Intergenic
1131373965 15:91908222-91908244 CCAAAAGCATCATCATTTTAGGG - Intronic
1132171979 15:99667601-99667623 ACAAAGGCAACATTTTTTTCAGG - Intronic
1133971323 16:10570207-10570229 AAAAAGCCACCATTTTTTCAGGG - Intronic
1135914479 16:26593284-26593306 CAAGAGTCATCTTTTTTTTAAGG + Intergenic
1143415934 17:6750233-6750255 CCAATTCCATATTTTTTTTATGG - Intergenic
1144453524 17:15400596-15400618 CCAAGACCCTCATTTCTTTAAGG - Intergenic
1146638043 17:34520454-34520476 CCATAGTCATCACTTTTTTTGGG - Intergenic
1147288940 17:39425897-39425919 CCAAAAACATCATTTTTGAAGGG + Intronic
1147477610 17:40728028-40728050 CCAAAACAATCATTTTCTTCAGG - Intergenic
1149334867 17:55625418-55625440 CCATTACCATCATTTTATTAAGG + Intergenic
1149722747 17:58862739-58862761 CCCAAGTAATCATTTTATTAGGG + Intronic
1153151645 18:2101946-2101968 CCAAAGCCATCATCATATAAGGG + Intergenic
1153717152 18:7861271-7861293 CACAAACCATAATTTTTTTAGGG - Intronic
1155644140 18:28057012-28057034 TCAACGGCATCATTATTTTAAGG + Intronic
1157020798 18:43779247-43779269 ACAAATACATCATTATTTTAGGG + Intergenic
1157195603 18:45617938-45617960 CCTAAGCCTTCATTTTTCTAGGG - Intronic
1157340728 18:46775956-46775978 CCAAACTCATCCTTTTTTTGAGG - Intergenic
1157438274 18:47689684-47689706 TTAATGCCATCATTTTTTTCTGG + Intergenic
1157541606 18:48514866-48514888 CCACAGCCAGCCTTTGTTTATGG - Intergenic
1158257254 18:55565780-55565802 CAAAAGACATCATTTTATTCTGG - Intronic
1159932314 18:74326339-74326361 GCAAAGCCAGCAATTTTTTCTGG + Intronic
1160017584 18:75156486-75156508 CCAAAGCCTTCCTTTCTTTAGGG + Intergenic
1160171866 18:76562029-76562051 ACGAACTCATCATTTTTTTATGG + Intergenic
1161895666 19:7077889-7077911 CCAATCTCATCATTTTTTTTAGG - Intronic
1162418889 19:10554438-10554460 CCAAAGCCAGCGCTTTTCTACGG + Intronic
1164118944 19:22248070-22248092 ACGAACTCATCATTTTTTTATGG + Intergenic
1164922761 19:32101961-32101983 CAAAAGACATGATTTTTTTATGG + Intergenic
1168489674 19:56797677-56797699 CCAAGGCCACCTTGTTTTTAGGG - Intronic
925517356 2:4698135-4698157 CCAAATCCAACAATATTTTAAGG + Intergenic
926107663 2:10162585-10162607 TCAAAGCCCTCACTTTTTTCTGG + Intronic
927224004 2:20743999-20744021 TCAAAGCCATTTTTATTTTACGG + Intronic
929278963 2:40057396-40057418 ACGAACTCATCATTTTTTTATGG - Intergenic
931326200 2:61227101-61227123 CTAAAGCTATCATCTTTTCAAGG + Exonic
933147366 2:78871009-78871031 GCAAAGCCCTCAATTTTTTAAGG + Intergenic
933535650 2:83570518-83570540 CCAAAGACATCATCTTAATAGGG - Intergenic
933875826 2:86621342-86621364 CCAAAGCCATCATTTTTTTATGG - Intronic
934667710 2:96184581-96184603 CCAAAGTGATCTTTTTTTAAAGG + Intergenic
935807732 2:106765626-106765648 ACAAAGACACCATTTTTTAAAGG - Intergenic
936260073 2:110951384-110951406 ACAAAGCTATCATTTTTCTCAGG - Intronic
938888852 2:135682211-135682233 CCAAAGTCATCATTTCTATGTGG + Intronic
939063827 2:137457932-137457954 CCAGAACCTTCATTTATTTAGGG - Intronic
939303292 2:140376428-140376450 CCAAAGCCAAGATATTTTCATGG + Intronic
940435895 2:153653896-153653918 CAAAATCCATTATTTTGTTAAGG - Intergenic
942327100 2:174785254-174785276 ACAAAGCCATATTTTTTTTAGGG + Intergenic
942471691 2:176267682-176267704 CCAGCCCCATAATTTTTTTAAGG - Intergenic
942997371 2:182279383-182279405 CCAAAGCCATTCTGTTTTGATGG - Intronic
943466112 2:188231068-188231090 CCAAACCCATCACTTTATTTCGG - Intergenic
943675204 2:190710424-190710446 CCTAGGCCAGCATTTTTTTCAGG + Intergenic
943866717 2:192933675-192933697 CACAGGACATCATTTTTTTATGG + Intergenic
945378601 2:209111153-209111175 CCTAAGTCATCATTTTGTCAGGG + Intergenic
945530445 2:210947217-210947239 CCAAACCTATCATTTACTTAGGG - Intergenic
947041626 2:225928501-225928523 CATAAGTCTTCATTTTTTTATGG + Intergenic
947163452 2:227237612-227237634 ACAAAGCTATCCTTTTTTTCAGG - Intronic
949074935 2:242049354-242049376 CAAAATCCAACATCTTTTTAAGG + Intergenic
1169829183 20:9804695-9804717 CCAAAGTTATCATTTTTCTTCGG - Intronic
1170507007 20:17037213-17037235 ATAAAGCCATCATATTTATAAGG + Intergenic
1171080884 20:22182632-22182654 ATAAAGACATCATATTTTTAGGG - Intergenic
1172096403 20:32462603-32462625 CTAAATCCATTTTTTTTTTAAGG - Intronic
1177297451 21:19194996-19195018 CCAATACCCTCAGTTTTTTATGG + Intergenic
1178174805 21:30084204-30084226 CAAAAGACATGATTTTTTTGAGG - Intergenic
1178950753 21:36983535-36983557 CCAAAAAAATCATTTTTATAAGG - Intronic
1179290337 21:40012962-40012984 TCAAAGCTACCTTTTTTTTACGG - Exonic
1179498341 21:41790131-41790153 CCAAAACCATGATTTTTTAATGG - Intergenic
1179566951 21:42254903-42254925 CCAAAGCCGTGATTTTTCTTTGG - Intronic
1180692434 22:17728288-17728310 CCAAAGGCAGCATTTTTACAAGG - Exonic
1182327049 22:29521200-29521222 CCAATGCCACCATTTATTGAAGG + Intronic
949713868 3:6905144-6905166 ACAAATCCAACCTTTTTTTAAGG - Intronic
950716269 3:14849851-14849873 CAGAAGCCAGCATTTTTTTTAGG - Intronic
953805835 3:46066541-46066563 CCACAGCCATCATTTCTTAGTGG + Intergenic
956683675 3:71804818-71804840 CCAAACCCTTATTTTTTTTAAGG + Intergenic
957182435 3:76897278-76897300 TTAAAGCCAGCATTTTTTTTTGG - Intronic
957295639 3:78329426-78329448 CCAAAGCTACCATATTATTAAGG + Intergenic
957437840 3:80201707-80201729 CAAAGGACATAATTTTTTTATGG - Intergenic
958188225 3:90150757-90150779 CCAAAGCCCTCATTCTATTTTGG + Intergenic
962206082 3:133434982-133435004 CCAAGGCCCTCAGTTCTTTAGGG - Intronic
962454437 3:135552172-135552194 ATACATCCATCATTTTTTTATGG + Intergenic
963437903 3:145295092-145295114 CTAAAGCCGTTATTTTCTTAAGG - Intergenic
963618015 3:147568242-147568264 CAAAATACATGATTTTTTTATGG - Intergenic
964954884 3:162341404-162341426 CCAATTCCTTCATTTTTTTATGG - Intergenic
965049728 3:163630216-163630238 CAAAGGACATGATTTTTTTATGG + Intergenic
965209833 3:165770692-165770714 CCAAAGCTGTAATTTTTTTAAGG + Intergenic
965422681 3:168481444-168481466 CCAAATCCATCATATTTTTTAGG - Intergenic
965746342 3:171929912-171929934 CCAGACCCATTATTTTTTAAAGG - Intronic
966555358 3:181253255-181253277 CAAAAGCCAACATTTGTTGAAGG + Intergenic
966989492 3:185214477-185214499 CCAAAGTCATCCATTTTTTTGGG + Intronic
967069246 3:185948087-185948109 CCACAGCCATCATCATTTCATGG - Intergenic
970652297 4:18192314-18192336 CCCAAGCCATTAGCTTTTTAGGG + Intergenic
970862924 4:20723970-20723992 TCAAAGCCTTCATTTTTATGGGG + Intronic
971130264 4:23801115-23801137 GCATTGCCATCATTGTTTTATGG - Intronic
971130876 4:23808993-23809015 TCAAAGCAATCATATATTTAGGG - Intronic
972258081 4:37380569-37380591 CCATAGCTAGCATTTATTTAAGG - Intronic
975185008 4:71391634-71391656 CCAAAGCTTTCTTTTTCTTATGG + Intronic
975265861 4:72366305-72366327 GAAAAGCCATCATCTTTTGAAGG - Intronic
976376243 4:84348849-84348871 CCAGTGCCATCCTTATTTTAGGG + Intergenic
979155087 4:117376269-117376291 AAAAAGCCATAATTTTTATATGG - Intergenic
980246490 4:130251491-130251513 TCATAGACATCATTTTTTAAAGG + Intergenic
981269622 4:142830249-142830271 CCAAAGCAAGAATTTTTCTAAGG + Intronic
982073398 4:151715735-151715757 TCAAAGCCATTATTTCATTAAGG + Intronic
983556389 4:169062847-169062869 CCAATGCCATCAGAATTTTAGGG - Intergenic
984995152 4:185423588-185423610 GCAAAAACATGATTTTTTTATGG - Intronic
985033145 4:185812362-185812384 TCAAACTCATCATTTTTTTGAGG + Intronic
985814146 5:2114081-2114103 CCAAGGTCATTTTTTTTTTAAGG + Intergenic
988559069 5:32264039-32264061 CCATGGCCATCATCTGTTTATGG - Intronic
989839674 5:46047030-46047052 ACGAACCTATCATTTTTTTATGG - Intergenic
990147150 5:52775228-52775250 CCAAACAGATCATATTTTTAAGG + Intergenic
990370893 5:55117259-55117281 CCATAGTCATGATTTTTTTTGGG - Intronic
990675558 5:58180989-58181011 CAAAGGGCATGATTTTTTTATGG - Intergenic
991134348 5:63163711-63163733 GAGAAGCCATCTTTTTTTTAAGG + Intergenic
991563707 5:67982749-67982771 CCGAATCCATCCTTCTTTTAGGG - Intergenic
993419184 5:87679046-87679068 CCACAGCGATTATTTATTTATGG - Intergenic
993467023 5:88261178-88261200 CCAAAGTATTCATTTTTTTCTGG - Intronic
994767446 5:103936676-103936698 CCAAAGCCTTCATTTTAGCATGG + Intergenic
994925986 5:106118002-106118024 CTAAAGCCATCAACTTATTATGG + Intergenic
995501723 5:112814373-112814395 TGAAAGCCATCATTTATTTCTGG + Intronic
995599391 5:113779248-113779270 CAAAAGCCCTGATCTTTTTAAGG + Intergenic
995661903 5:114493954-114493976 CTAAAGTGATCACTTTTTTATGG + Intronic
996138288 5:119872585-119872607 CCAGAGCCATCAATTCTTCATGG + Intergenic
997534233 5:134604598-134604620 CCAAAGACATAAGATTTTTATGG - Exonic
998347915 5:141480735-141480757 ACATAGGCATCATTTTTTGAAGG + Intronic
998919921 5:147056790-147056812 CCAAAGTCATTATTATTTCATGG - Intronic
999403233 5:151283655-151283677 CCACAGCCTTCATTTTTCCAAGG - Intronic
1000080577 5:157841612-157841634 TCTGAGCCATCATTTTTTTTCGG + Intronic
1001996747 5:176167557-176167579 CCAAAGAAATAATTTTTTAAAGG + Intergenic
1004377202 6:15100985-15101007 TCAAAACCATCATTTTATTTGGG + Intergenic
1004419597 6:15456678-15456700 CCAAATCCATCAGATTTTCAGGG - Intronic
1004671995 6:17806231-17806253 CCATAACCATGATTTTTTAATGG + Intronic
1007140212 6:39564957-39564979 CCAAAGTTTTCATTTTGTTAAGG - Intronic
1007749587 6:44063814-44063836 CCAAAGCCATCATTTCTGTGGGG - Intergenic
1008292646 6:49736643-49736665 CCAAAGCTATGACTTTTTAATGG + Intronic
1008493629 6:52111098-52111120 CCAAAGCCATCATTTTTCAATGG + Intergenic
1009833567 6:68969783-68969805 CTAAAGCCATCAATGTTTCAGGG + Intronic
1010567657 6:77436489-77436511 CCAAAACCTTTAATTTTTTAAGG - Intergenic
1010823137 6:80439895-80439917 ACAAAGCCATTATTGTTTTCTGG + Intergenic
1011159561 6:84373502-84373524 CCAAAGTCATCTTTTCTTTCTGG + Intergenic
1011322253 6:86108618-86108640 TCAAAGTAATCATTTGTTTAGGG - Intergenic
1011933586 6:92744729-92744751 CCAAAGCAATCAGTGTTTTGTGG - Intergenic
1014657399 6:124125533-124125555 CCAGAGCCATCCTTTTAATATGG + Intronic
1015457822 6:133448838-133448860 ACAAAGCCATCACATTTTTGTGG + Intronic
1015941776 6:138459686-138459708 CCAAATCCAACAATTTTTAATGG - Intronic
1016169590 6:140994829-140994851 CCAAATGTTTCATTTTTTTAAGG - Intergenic
1020397889 7:7737698-7737720 CAAAAACAATCATTTTTTGATGG - Intronic
1020978476 7:15038070-15038092 ACAAAACCATCATTTTCTTCAGG + Intergenic
1021413984 7:20360662-20360684 CAAAGGACATTATTTTTTTACGG + Intronic
1022636710 7:32142997-32143019 CAAAAGCTGTCATTTTTTGAGGG - Intronic
1023221656 7:37925284-37925306 CCCAAGCCACCATTTTGTAAGGG - Intronic
1023268374 7:38433127-38433149 CGAAAACCATCATATTTTTAAGG - Intronic
1024013285 7:45288855-45288877 CCAAAGCCATCTTTTTGTGGGGG - Intergenic
1026347848 7:69490395-69490417 CCAAATCAATCATTTCTTTTTGG - Intergenic
1026442040 7:70453180-70453202 CCAAAGCCCACATTCTTTGAGGG - Intronic
1026651569 7:72220365-72220387 ACGAACTCATCATTTTTTTATGG + Intronic
1027172513 7:75882731-75882753 CAAAAGTCAACATTTTTTAAAGG - Intronic
1027244307 7:76356513-76356535 AGGAAGTCATCATTTTTTTAAGG + Intronic
1027610305 7:80352038-80352060 CCAAAACCTTCATTTCTTAAGGG + Intergenic
1027619047 7:80460450-80460472 CCAAGTCCATCATTTAATTAGGG - Intronic
1027935903 7:84601803-84601825 CCAAATCCATCACTATTTTTAGG + Intergenic
1028646293 7:93100473-93100495 CCATATCCATAATTTTATTAGGG + Exonic
1030711617 7:112756937-112756959 ACAGAGACAGCATTTTTTTAGGG - Intergenic
1031072200 7:117174002-117174024 TCAAAGCCAAACTTTTTTTAAGG - Intronic
1032676901 7:134138487-134138509 CCAAAGTCATAAGTTTCTTAAGG + Intronic
1032836208 7:135677049-135677071 CCAGAACCATCATAGTTTTAGGG + Intronic
1033476102 7:141694699-141694721 CCAAAGCAATCAATGTATTAGGG + Intronic
1034156530 7:148960118-148960140 GAAAAATCATCATTTTTTTAAGG - Intergenic
1036343864 8:7942207-7942229 CAAAGGACATAATTTTTTTATGG + Intronic
1036464638 8:8985131-8985153 CCATTTCTATCATTTTTTTAGGG - Intergenic
1036539160 8:9686866-9686888 CCAAATTCTTCATTTTTTTTAGG - Intronic
1036839205 8:12102974-12102996 CAAAGGACATAATTTTTTTATGG + Intergenic
1036860994 8:12349217-12349239 CAAAGGACATAATTTTTTTATGG + Intergenic
1038098645 8:24345947-24345969 CCCAAGCCTTGTTTTTTTTAGGG + Intronic
1038125014 8:24663848-24663870 CCCAAGCTCTCATTTTTTTAAGG + Intergenic
1038978395 8:32727305-32727327 CAAACGCCATCATACTTTTAAGG - Intronic
1039691328 8:39867876-39867898 CCAGAGCCATGCTTCTTTTACGG - Intergenic
1039692186 8:39875745-39875767 CCAAAGCCATCCCTTTATTTCGG + Intergenic
1040651638 8:49455717-49455739 CCAAAGTCATCATTCTTGTCAGG - Intergenic
1041208255 8:55520728-55520750 AGAAAGCCTTCATTTTTCTACGG + Intronic
1043744915 8:83862341-83862363 CAAAAGATTTCATTTTTTTATGG - Intergenic
1044089034 8:87976414-87976436 TCAAAAACATTATTTTTTTAAGG + Intergenic
1044786111 8:95795009-95795031 CCAAAAACATGATTTTTTTGTGG + Intergenic
1044852732 8:96444947-96444969 CCACAGACAGCATTGTTTTAGGG + Intergenic
1045286655 8:100797427-100797449 CCGAAGCGTTCATGTTTTTAAGG + Intergenic
1045848862 8:106669934-106669956 ACAAAGCAAACATTTTATTAAGG + Intronic
1048576274 8:135692653-135692675 CCAAAGCCAGCATTTTCATATGG - Intergenic
1048904785 8:139076987-139077009 CCAAGGACATCATTTTTCTGTGG - Intergenic
1049041024 8:140111841-140111863 CAAAAGCCATAAATATTTTAAGG - Intronic
1049981679 9:909514-909536 CTAAAGCCATCATTTAATGAGGG + Intronic
1051495454 9:17717845-17717867 CCATACCCATTATTTTTTTCTGG + Intronic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1058280687 9:103109834-103109856 CCAAAGAAATAGTTTTTTTATGG - Intergenic
1058331693 9:103769411-103769433 CCAATATCATCATTCTTTTAGGG - Intergenic
1059708215 9:116843256-116843278 CAAAGGACATGATTTTTTTATGG - Intronic
1060573202 9:124663046-124663068 CCTAATTCATCATTTCTTTAAGG - Intronic
1061180927 9:129024708-129024730 CCAAAGTCTTTCTTTTTTTAAGG - Intronic
1186498782 X:10033907-10033929 CCAAAGTCTGCATTTTCTTAAGG + Intronic
1187978722 X:24731784-24731806 CCAAACCCATCATTTTATCTGGG - Intronic
1188409849 X:29858471-29858493 CCAATGCCAGCCATTTTTTATGG + Intronic
1189315808 X:40055802-40055824 CCAAATCTATCCTTTTTTTGCGG + Intronic
1189740931 X:44116627-44116649 CCAATGCCCTGATTTCTTTAGGG + Intergenic
1192121447 X:68460029-68460051 CCAGAGCCATTATTTTATTAGGG - Intergenic
1192252811 X:69427176-69427198 TCAAAAACTTCATTTTTTTAAGG + Intergenic
1192419928 X:71020606-71020628 CCAAAGCCATCATGTACTTTTGG + Intergenic
1193326816 X:80187867-80187889 CATAACTCATCATTTTTTTATGG + Intergenic
1193775798 X:85640576-85640598 CCAAAGCCTTCTAATTTTTAGGG + Intergenic
1194028034 X:88778226-88778248 CCTTAGCCATTTTTTTTTTAGGG + Intergenic
1194630906 X:96282306-96282328 CCAAAGGCAAGATGTTTTTAGGG - Intergenic
1194818525 X:98475985-98476007 CCAAAGCCATGATTAATCTAAGG + Intergenic
1195765684 X:108294475-108294497 CCAAAGCCATCAATTCCTTAAGG + Intronic
1196044375 X:111242055-111242077 CCAAAGCCATCTGTTGTTAATGG + Intergenic
1197163407 X:123348933-123348955 TTAAAGCCATCATATCTTTAGGG - Intronic
1198273212 X:135075120-135075142 CCAAAGCCATCTTTGCTTTTAGG + Intergenic
1198412236 X:136382555-136382577 CCCAAGCCTTCATTTTTGAAGGG + Intronic
1198887155 X:141352068-141352090 CCAAAGCCATCTCTCTTTTCAGG - Intergenic
1199075615 X:143521949-143521971 ATGAAGTCATCATTTTTTTATGG + Intergenic
1200106869 X:153719096-153719118 ACAAAGCCTTCATTCTTTTTTGG - Intronic
1201292089 Y:12430238-12430260 CCAAAGCCACTAATTTTTCAGGG + Intergenic
1201426894 Y:13861224-13861246 CCAAAAGCATCCTATTTTTATGG - Intergenic
1201483514 Y:14467384-14467406 CCATATCCACCATTTTTTTAAGG + Intergenic
1201602126 Y:15742673-15742695 ATAAACTCATCATTTTTTTATGG + Intergenic
1201978112 Y:19874653-19874675 CAAAAGACATTATTTTTTTATGG - Intergenic