ID: 933876439

View in Genome Browser
Species Human (GRCh38)
Location 2:86624935-86624957
Sequence GTGTCAGTCTTGAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 291}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933876435_933876439 4 Left 933876435 2:86624908-86624930 CCGAGCGTACTCTTTACGTCAAT 0: 1
1: 0
2: 0
3: 2
4: 21
Right 933876439 2:86624935-86624957 GTGTCAGTCTTGAGGGAGGAAGG 0: 1
1: 0
2: 2
3: 17
4: 291
933876434_933876439 9 Left 933876434 2:86624903-86624925 CCGGGCCGAGCGTACTCTTTACG 0: 1
1: 0
2: 0
3: 2
4: 18
Right 933876439 2:86624935-86624957 GTGTCAGTCTTGAGGGAGGAAGG 0: 1
1: 0
2: 2
3: 17
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933876439 Original CRISPR GTGTCAGTCTTGAGGGAGGA AGG Intronic
900213207 1:1467536-1467558 GTGACGGTGTTGTGGGAGGATGG + Intronic
900218434 1:1494646-1494668 GTGACAGTGTTGTGGGAGGATGG + Intronic
900747613 1:4371868-4371890 CTGTCAATCTGGAAGGAGGAAGG - Intergenic
900825271 1:4921158-4921180 GTGTGGGTCTCGGGGGAGGATGG + Intergenic
901051799 1:6429083-6429105 GTGTGAGTCTTGGGGAGGGAGGG + Intronic
902482163 1:16717744-16717766 GGGTGAGTGCTGAGGGAGGAAGG - Intergenic
903643582 1:24876700-24876722 CTGGGAGTCATGAGGGAGGATGG - Intergenic
904491049 1:30859257-30859279 GTGGCAGTCTGCAGGGAGGTAGG - Intergenic
904592964 1:31625470-31625492 GAGTCAGACCTGTGGGAGGAGGG + Intronic
905237940 1:36563087-36563109 GTGGGAGTCCTGAGAGAGGAAGG - Intergenic
905238750 1:36568359-36568381 CTATCTGCCTTGAGGGAGGAGGG - Intergenic
906089383 1:43165555-43165577 GTGACAGACTTGAGGGAAGCTGG - Intronic
907190664 1:52645259-52645281 GGGTCACTTTTGAGGGTGGAAGG + Intronic
907710463 1:56876005-56876027 GTGTGAGTCTGGAGGGAGAGGGG + Intronic
907761508 1:57366135-57366157 GTTTTGGTCTTGAAGGAGGAAGG - Intronic
909043959 1:70686733-70686755 ATGCCAGTCTGGAGGCAGGAGGG + Intergenic
910075990 1:83279819-83279841 GTGTCAGTGGTGTGGGGGGAGGG - Intergenic
910602796 1:89049930-89049952 TTCTCAATCTTGAGGGAGAATGG - Intergenic
911368601 1:96970384-96970406 GAGTCAGTCTTGAGGGGCAAAGG + Intergenic
911477385 1:98390265-98390287 GTGGCAAACTAGAGGGAGGAAGG + Intergenic
911812654 1:102303186-102303208 GAGTTTGTCTTGAGGGAGGGTGG + Intergenic
912684331 1:111750094-111750116 GCCTCAGTCTTTAGGGAGGAAGG - Intronic
913521066 1:119646912-119646934 CGCTCAGTCTTGAGGGAGGAGGG + Intronic
915782345 1:158566766-158566788 GGGTCAGTCCTGAGGGATGTGGG + Intergenic
916695516 1:167231993-167232015 GTGTGTGTGTTGGGGGAGGAGGG - Intronic
917106210 1:171494778-171494800 GTTTCTTTCTTGAGGGAGGGGGG - Intronic
919085621 1:192917480-192917502 GTGTCCTTCTTGAGGTATGATGG - Intergenic
921475934 1:215609664-215609686 GTGGCAGGCATGAGAGAGGAAGG + Intronic
922055766 1:222041130-222041152 GTGTCAGTGTTGGGTGAGAATGG - Intergenic
922318740 1:224465686-224465708 ATGTCAACATTGAGGGAGGAGGG - Intronic
923258175 1:232240398-232240420 GAGTCATTATTGAAGGAGGAGGG - Intergenic
923512941 1:234668528-234668550 GTGACAGTATTGAGAGATGAGGG + Intergenic
924814211 1:247428098-247428120 GAGTCTGTCCTGAGGAAGGAAGG - Intronic
1063035155 10:2279825-2279847 GTGTCCCTCCTGAGGGGGGATGG + Intergenic
1064857496 10:19786429-19786451 GGGTCCTACTTGAGGGAGGAGGG + Intronic
1065804880 10:29385055-29385077 GAGTCAGGCTGGTGGGAGGAGGG - Intergenic
1065944256 10:30592727-30592749 GAGTCAGGCTGGTGGGAGGAGGG + Intergenic
1066092751 10:32041865-32041887 TTGTGAGGCTTGAGGCAGGAGGG - Intronic
1067210433 10:44256400-44256422 GTGTTGGCCTTGAGGGAGAACGG + Intergenic
1067562843 10:47315874-47315896 GTTTCATTCTGGAGGGAGCAGGG + Intergenic
1067943670 10:50677291-50677313 GAGTCTGTGTTTAGGGAGGACGG + Intergenic
1070475477 10:76825036-76825058 GAGTGAGGCTTAAGGGAGGATGG - Intergenic
1070865156 10:79704158-79704180 GAGTCTGTGTTTAGGGAGGACGG + Intronic
1070878947 10:79842289-79842311 GAGTCTGTGTTTAGGGAGGACGG + Intronic
1071632052 10:87226379-87226401 GAGTCTGTGTTTAGGGAGGACGG + Intronic
1071645505 10:87358598-87358620 GAGTCTGTGTTTAGGGAGGACGG + Intronic
1072191620 10:93080800-93080822 CTGTCAGTTTTGAGGGAGCAGGG + Intergenic
1072862441 10:99020641-99020663 GTGTATGTGTTGAGGGAGGGTGG + Intronic
1073474324 10:103742946-103742968 GTGTCACCCTTGAGGGGGGGAGG - Intronic
1074124461 10:110517028-110517050 GTGTAAGTGTGGAAGGAGGAGGG + Intergenic
1074228203 10:111508155-111508177 GTCTCAATCTGGAAGGAGGAAGG - Intergenic
1075926726 10:126257091-126257113 GTGTCAGTGTTCAGGGAGGAAGG - Intronic
1077587527 11:3465269-3465291 GTGTTTGTCTTGAGGGACGGCGG + Intergenic
1078179594 11:8999981-9000003 CTTTCATTCTTGTGGGAGGAAGG - Intronic
1078375945 11:10793101-10793123 GTGACAGTGTTGAAGGAGGGAGG + Intergenic
1078688066 11:13551320-13551342 GTGTCAGTCAGGAGGCAGAAAGG + Intergenic
1080017265 11:27520801-27520823 CTGTCAGTGTTGGGGGACGAGGG - Intergenic
1080585449 11:33677518-33677540 TGGTCATTCTTGAGGGAGTAGGG + Intergenic
1081261878 11:40971420-40971442 GTGTTAGGCCTGGGGGAGGAGGG + Intronic
1081322165 11:41704637-41704659 GGGTCAGTCTTGAGGCAGCGAGG - Intergenic
1081685704 11:45041698-45041720 GAGGCAGTCTTGGGGGAGGCTGG - Intergenic
1081866085 11:46361537-46361559 GTCTCAGGCTGCAGGGAGGAGGG + Intronic
1081911381 11:46701881-46701903 GTGTCAGCAGTGAGTGAGGAAGG + Intronic
1088158742 11:106842216-106842238 CTGTCAATCTTGATGGAGCAAGG - Intronic
1088984332 11:114892263-114892285 GGGTCAGTACAGAGGGAGGAAGG + Intergenic
1090218952 11:124998360-124998382 TTCTCAGTCTTCAGGCAGGAAGG + Intronic
1090339096 11:125999723-125999745 GTGACAGTGTGGATGGAGGAAGG - Intronic
1091162968 11:133442763-133442785 GTGTCTTTTTTGAGGGAAGAAGG + Intronic
1091588233 12:1828062-1828084 CTGTCAGTCCTGAGGGAGGGAGG - Exonic
1091784911 12:3237499-3237521 GTGTCCTTGGTGAGGGAGGAGGG - Intronic
1092045530 12:5430034-5430056 CTGGCAGTCTGGAGGGAGGAGGG - Intergenic
1097022142 12:56027952-56027974 GTGTCTGTCCAGTGGGAGGAGGG + Intronic
1097036810 12:56129518-56129540 GTGCCAGTCTAGGGGGAGAATGG + Intronic
1097910988 12:64969000-64969022 GTGTCTGCTTTGGGGGAGGATGG + Intergenic
1098343467 12:69475341-69475363 GTGTCAGTGTTGTTGGAGGCAGG + Intronic
1098869750 12:75803313-75803335 GTGTCTGTCTTGAGGAAGAAAGG + Intergenic
1098998490 12:77149331-77149353 GTGTGTGTGTTGAGGGAGGGAGG - Intergenic
1100276427 12:93075885-93075907 GTGTCAGTCTGGTGGGACCATGG + Intergenic
1103944446 12:124518311-124518333 GTGTCATCCTGGAGGAAGGATGG - Intronic
1105510994 13:21051624-21051646 GTGTCAGTGGTGGAGGAGGAAGG + Intronic
1107543923 13:41419129-41419151 GTGGCTGTCTTTGGGGAGGAAGG + Intergenic
1107885040 13:44868014-44868036 GAGTCAGCCCTGAGGGAGGAGGG - Intergenic
1110301177 13:73929012-73929034 GTGTGAGTTATGAGGGATGAAGG - Intronic
1112730491 13:102355045-102355067 GTGACAGTCTTCAGGGAAAAAGG + Intronic
1113382933 13:109820363-109820385 GAGACACGCTTGAGGGAGGAAGG - Intergenic
1114437289 14:22716989-22717011 GTGGCAGAGTTGAGGGGGGAGGG - Intergenic
1114484945 14:23056877-23056899 GTGTCTGCTCTGAGGGAGGAGGG - Intronic
1114760790 14:25311732-25311754 GGGTCAGTCTGGAGGCAGAAGGG + Intergenic
1116621663 14:47211622-47211644 GTGTCTGCCTTTAGGGAAGAGGG - Intronic
1117372175 14:55088678-55088700 ATTTCAGTCTTGAGGCAGAATGG + Intergenic
1118243031 14:64080144-64080166 TTGTCACTCTTGAGAGATGAGGG + Intronic
1118875784 14:69783843-69783865 GTGTGAGTGGTGAGGGAGAAGGG + Intronic
1119740909 14:77013233-77013255 GGATGAGTCTTGAAGGAGGAGGG + Intergenic
1119871975 14:78025829-78025851 GTGTGTGTGTTGGGGGAGGAGGG + Intergenic
1121224937 14:92314765-92314787 GGCTCATTCTTGAGGCAGGATGG + Intergenic
1121228498 14:92339429-92339451 GTGACAGTCCTGAGGGTAGATGG + Intronic
1121536442 14:94694367-94694389 GCCCCAGTCTTGAGGGAGGGTGG - Intergenic
1121619647 14:95337302-95337324 GTGGCAGCCATGAGGGAGGCTGG + Intergenic
1121735382 14:96214354-96214376 CTGTCATTCCTGAGAGAGGACGG + Intronic
1122562524 14:102626494-102626516 GGGACAGGTTTGAGGGAGGATGG + Intronic
1122778934 14:104135588-104135610 ATGCCTGGCTTGAGGGAGGAAGG - Intergenic
1122846470 14:104502775-104502797 CTGTCAGCCTTAAGGAAGGACGG + Intronic
1127341545 15:58049996-58050018 GTGTGGGTCTTGAGGGGGAAGGG + Intronic
1128750538 15:70145689-70145711 CTGCCAGTCTTGAGGGATGTGGG + Intergenic
1128932167 15:71715030-71715052 GGGTCAGTCTTGCAGGAGTATGG + Intronic
1129878850 15:78994208-78994230 GGGTCAGTCTGGAGGAAGTAGGG + Intronic
1130059771 15:80560972-80560994 GGGACAGTGTGGAGGGAGGATGG + Intronic
1131297681 15:91165654-91165676 GAGACAGACCTGAGGGAGGAAGG + Intronic
1132109109 15:99089247-99089269 GTGTGAGGCTGGAGGGAAGAGGG - Intergenic
1132501499 16:286472-286494 CTGTGAGTGTTGAGGGAGGCAGG + Exonic
1132710104 16:1262702-1262724 GTGTCCTTCCTGGGGGAGGACGG + Intergenic
1133354940 16:5129214-5129236 GTGTTTGTCTTGAGGGACGGCGG + Intergenic
1134803735 16:17107867-17107889 GTGGCAGCCTTGAGGGAAGGAGG + Exonic
1139228854 16:65261620-65261642 ATTTCATTTTTGAGGGAGGATGG + Intergenic
1139255886 16:65542222-65542244 GTGGCAGTTATAAGGGAGGAAGG + Intergenic
1139279020 16:65753926-65753948 GTGTTAGTCTTGATGGAGAGTGG + Intergenic
1140202835 16:72908190-72908212 GTGTCAATCCCCAGGGAGGAGGG - Intronic
1140412642 16:74750152-74750174 GTCTCAGTCTTGAGAGACTACGG - Intronic
1141492321 16:84382494-84382516 GGGTCAGTCCTGGGGCAGGATGG + Intronic
1141682937 16:85554765-85554787 CTGTCAGTCGTGGGGGGGGAGGG + Intergenic
1142611806 17:1112586-1112608 GACTCTGTCTTGAGGGAGGGAGG + Intronic
1144811421 17:18002347-18002369 GTATTAGTCATGAAGGAGGATGG - Intronic
1147586675 17:41657095-41657117 GTATCATTCTTGGGGCAGGAGGG - Intergenic
1150073398 17:62171663-62171685 GTGTCAGCTGTGAGGAAGGAAGG + Intergenic
1151360480 17:73585638-73585660 TAGTCAGGCCTGAGGGAGGATGG - Intronic
1152088115 17:78232377-78232399 CTGTCAGTTTTGGGGGAAGACGG - Intronic
1153255097 18:3162480-3162502 GTGTCAGTCATGAGTCAGAAGGG - Intronic
1153762414 18:8344723-8344745 GTGTGAGTGTTGGGGGAGGGTGG + Intronic
1154397085 18:14000766-14000788 GTGTCAGTTTGGAGGGTGGACGG - Intergenic
1155490628 18:26398053-26398075 GTGACAGCCCTCAGGGAGGAGGG - Intergenic
1157475284 18:48020142-48020164 GTGGAAGTCTGGATGGAGGAGGG - Intergenic
1158167899 18:54562093-54562115 GTGTCACTCCTGAAAGAGGATGG - Intergenic
1158403418 18:57140911-57140933 GTGTCAGTGAAGAAGGAGGAAGG + Intergenic
1158467304 18:57702216-57702238 GAGGCTGTCTTGATGGAGGAAGG - Intronic
1159160530 18:64638392-64638414 GTGTCAGTAATGAGAGTGGAGGG - Intergenic
1159669587 18:71206442-71206464 GTGTCAGTCTCTAGAAAGGAAGG - Intergenic
1160043100 18:75363212-75363234 GTATCAGTCTCGAGGGGCGATGG - Intergenic
1160062365 18:75544152-75544174 GGGTCACTCTTGATGGTGGAGGG - Intergenic
1160090441 18:75821711-75821733 GGGTCAGTCTTCAAGGACGATGG + Intergenic
1163586753 19:18168551-18168573 GTGACCGTCTGGAGGGAGGCAGG + Intronic
1163641444 19:18464702-18464724 GTGCCGGGCTTCAGGGAGGAGGG - Intronic
1163700036 19:18782363-18782385 GTGTCACCCCTGAGGGAGGAGGG - Intergenic
1163830879 19:19546666-19546688 GTGTCAGGCTCTAGGGAGGAAGG + Intergenic
1164815176 19:31193407-31193429 GTGGCTGTCTTGATGGATGAGGG + Intergenic
1165164049 19:33838969-33838991 GGGTTAGGGTTGAGGGAGGATGG + Intergenic
927520827 2:23696994-23697016 GTGTGTGGCTGGAGGGAGGAAGG - Intronic
929027516 2:37618984-37619006 GAATTAGTCTTGAGGCAGGAAGG - Intergenic
930357881 2:50344945-50344967 GTGTGAGTCCTGAGGGACGGAGG - Intronic
930956396 2:57207769-57207791 GTGTCAGTGTTGGTGGTGGAGGG - Intergenic
932101750 2:68907753-68907775 GTGTTAGACATGAGGGAGGCAGG + Intergenic
932802520 2:74754112-74754134 GTCTCAGTCTAAAGAGAGGAGGG - Intergenic
933532664 2:83530316-83530338 GTGTCAGCTTTGTGGAAGGAAGG - Intergenic
933559420 2:83873266-83873288 GGATCAGTCATGAGCGAGGATGG + Intergenic
933876439 2:86624935-86624957 GTGTCAGTCTTGAGGGAGGAAGG + Intronic
935899636 2:107777348-107777370 CTGTCAGACTTGAGGTTGGAAGG - Intergenic
937080948 2:119139327-119139349 GGGTCTGTCATGAGTGAGGAAGG + Intergenic
938725572 2:134105983-134106005 GTGCCATTCTTGAGTGAGGTGGG - Intergenic
940308579 2:152252974-152252996 GTGACAGAGTTGAGGCAGGAGGG - Intergenic
940357548 2:152762015-152762037 GTGTCAGACTGGAGAGAGGAGGG - Intergenic
941365738 2:164609142-164609164 GCTTCAGTCTTGAAGGAGGTGGG - Intronic
941895240 2:170622469-170622491 GGGTAAGGCTTGTGGGAGGAAGG - Intronic
943570978 2:189575028-189575050 ATGCCACACTTGAGGGAGGAGGG - Intronic
944036228 2:195297759-195297781 GTGTCAGTCATGAGAGATGCAGG + Intergenic
948002321 2:234578346-234578368 GTGTGTGTTTTGGGGGAGGAGGG - Intergenic
948248130 2:236503677-236503699 GAGACAGTCTCGAGGGAAGAGGG - Intronic
1168862185 20:1053570-1053592 CTGTCTGGCTGGAGGGAGGAGGG - Intergenic
1169075672 20:2758677-2758699 GTCTCTCTCTTGAGGGAGGTAGG + Intronic
1169994392 20:11540769-11540791 GTGACAGGCTTGGGGCAGGAAGG + Intergenic
1170363227 20:15570409-15570431 GGATCAGTCTTGATGGGGGACGG + Intronic
1172332445 20:34084747-34084769 ATGTCAGACATGAGAGAGGAAGG + Intronic
1173170270 20:40717781-40717803 GTTTCAGCCTCGAGGGAGGGGGG - Intergenic
1173215555 20:41079027-41079049 GTGTCAGTATTCAGGCAGGAGGG + Intronic
1173868525 20:46328201-46328223 GTGGCAGCCTTGATGGGGGAGGG - Intergenic
1174518520 20:51112122-51112144 GTGGCAGGCTTGAGAGCGGAGGG + Intergenic
1175181424 20:57150759-57150781 GTGTGAGCCATGAAGGAGGAAGG + Intergenic
1176106914 20:63393766-63393788 GTGCCAGCCCTCAGGGAGGACGG + Intergenic
1176146753 20:63568874-63568896 GTGTCTGGCATCAGGGAGGAGGG + Exonic
1176861361 21:14013138-14013160 GTGTCAGCCTTGCTGGAGGCCGG + Intergenic
1176872014 21:14091613-14091635 ATATGAGTCTTGAGGAAGGAGGG - Intergenic
1178996335 21:37404055-37404077 TTCTTAGTCTTGAAGGAGGAAGG + Intronic
1179314315 21:40228002-40228024 CTGTCAGTCTTGAGGAATGCTGG + Intronic
1180793759 22:18591929-18591951 GTCACAGTCATGAGGGAGGCTGG + Intergenic
1181227981 22:21403391-21403413 GTCACAGTCATGAGGGAGGCTGG - Intergenic
1181250672 22:21531448-21531470 GTCACAGTCATGAGGGAGGCTGG + Intergenic
1181306813 22:21921686-21921708 GTCTCAGTCTGGAGGCAGCAGGG - Exonic
1181464402 22:23102983-23103005 TGGTAAGCCTTGAGGGAGGAGGG + Intronic
1181540211 22:23569002-23569024 GTGTCCTTCCTGAGAGAGGAGGG + Intergenic
1181644954 22:24226112-24226134 GTGTCTGTGCTGGGGGAGGATGG - Exonic
1182521873 22:30889397-30889419 GTGCCAGTCCTCAGGGTGGAGGG + Intronic
1184654681 22:45935159-45935181 CTGTCAGCCTGGAGGAAGGATGG - Intronic
1185278190 22:49958875-49958897 ATGTCAGTCTGGAGGGGCGAGGG - Intergenic
949408525 3:3739699-3739721 GTGTGTGTGTTGGGGGAGGAAGG - Intronic
949851436 3:8424839-8424861 GAGTCATTGTTGAGAGAGGAGGG - Intergenic
953391611 3:42536921-42536943 GGGTCAGTCTGGTGGGAGGACGG + Exonic
953782580 3:45884598-45884620 GAGTGAGTCTCGGGGGAGGAAGG - Intronic
954318466 3:49814084-49814106 GTGTCAGACCTGAGGGTGGGAGG + Intergenic
955141834 3:56277444-56277466 GTGACAGTCACGAGGGAGGCAGG - Intronic
956606641 3:71079485-71079507 TTGTCTGTGTCGAGGGAGGATGG - Intronic
957819929 3:85359104-85359126 GTGTTAGGCTTGACTGAGGAGGG + Intronic
957906182 3:86559022-86559044 GGGAGAGTCTTGTGGGAGGATGG + Intergenic
961294642 3:125874819-125874841 GTGTTTGTCTTGAGGGACGGCGG - Intergenic
961891322 3:130132658-130132680 GTGTTTGTCTTGAGGGATGGCGG + Intergenic
962642892 3:137406761-137406783 GAGTGAGTGTGGAGGGAGGAGGG + Intergenic
963768528 3:149364612-149364634 ATGTGAGTCTTGGTGGAGGAGGG + Intergenic
965419214 3:168436406-168436428 GTATGTGTGTTGAGGGAGGAAGG - Intergenic
968222063 3:196947038-196947060 GTGGGAGTCATGAAGGAGGACGG + Exonic
969002717 4:3995101-3995123 GTGTTTGTCTTGAGGGACGTCGG + Intergenic
969418175 4:7074625-7074647 GAGTCAGCCTTGAGGCAGGAAGG + Intergenic
969751307 4:9113428-9113450 GTGTTTGTCTTGAGGGACGGTGG - Intergenic
969811217 4:9649711-9649733 GTGTTTGTCTTGAGGGACGTCGG - Intergenic
976324026 4:83750536-83750558 GTGTCAGGGTTGAGGCTGGAGGG + Intergenic
976753375 4:88473312-88473334 GGGTGAGGCTAGAGGGAGGAAGG - Intronic
977135885 4:93303448-93303470 TTGTCATTCTTGGGGTAGGATGG + Intronic
977290420 4:95159726-95159748 GTGGCAGTCTTGGGAGAGGAAGG + Intergenic
978288216 4:107104315-107104337 GTGTTAGTCCTGAGGTAAGATGG + Intronic
978714304 4:111823235-111823257 TTGTCAGTCTTGAGTGGGGTTGG + Intergenic
981688745 4:147482695-147482717 GTGTCATTGTTGGAGGAGGAAGG + Intronic
982639854 4:157944721-157944743 GTGACAGTATTGAGAGAGGTGGG - Intergenic
984070696 4:175108514-175108536 GTGTCAGTCATGAGGCAGAGAGG + Intergenic
984582071 4:181521682-181521704 ATGGCAGTGCTGAGGGAGGAAGG - Intergenic
986104894 5:4650325-4650347 GGCCCAGTGTTGAGGGAGGAAGG - Intergenic
989793025 5:45430445-45430467 GGGGCAGACTTGAGGGTGGAGGG - Intronic
990727477 5:58772927-58772949 GTGTCAGGTTTTAGGTAGGAAGG + Intronic
991456091 5:66806211-66806233 TTGTCAGGCTTGATGGATGAGGG - Intronic
991495030 5:67218209-67218231 GTGTCAGAATAGAGGGAGCAAGG + Intergenic
992862112 5:80921525-80921547 ATGGCCCTCTTGAGGGAGGAGGG + Intergenic
996543957 5:124658129-124658151 GTGATAGTGTTGGGGGAGGAGGG + Intronic
997500698 5:134371377-134371399 GTGTGAGTGCTGGGGGAGGAGGG - Exonic
998874782 5:146588205-146588227 GTCTCAGAATTGAGGGAGCATGG - Intronic
999202571 5:149826658-149826680 CTGTCAATCTGGAGTGAGGAGGG - Exonic
1002762758 6:214629-214651 GACTCAGTCTTGAGGAAGGTTGG + Intergenic
1005283735 6:24302508-24302530 GTGTCAGTCTTAAGAGAAAAGGG - Intronic
1005713374 6:28523715-28523737 GTGCCAATCTTATGGGAGGAGGG + Intronic
1006082713 6:31576669-31576691 GTTTTGGTCTTGGGGGAGGATGG + Intronic
1007809859 6:44478064-44478086 GTGCCAGGCTGGAGGGAAGAGGG + Intergenic
1007960347 6:45953348-45953370 GGGTGAGTCTGGAGGGAGGTTGG + Intronic
1008899387 6:56594256-56594278 CTGTCAGTCTTGAGGCGGCAAGG - Intronic
1010169133 6:72954291-72954313 GTGTAAGTGCTGTGGGAGGAAGG + Intronic
1013616631 6:111849562-111849584 GTGGCAGGCTGGAGGGAGAAAGG + Intronic
1013639256 6:112057376-112057398 AAGTCATTCTGGAGGGAGGAAGG + Intronic
1014293929 6:119594700-119594722 GTGTATGTATTTAGGGAGGAGGG - Intergenic
1016692812 6:146958189-146958211 GTGGCAGTCTAGAGGGAAGGTGG + Intergenic
1017198186 6:151724335-151724357 CTGTCAGTCTTGAGGAAGGAGGG - Intronic
1017945890 6:159095919-159095941 GGATCAGTCCTGAGGGAAGAGGG + Intergenic
1018977228 6:168574743-168574765 GTGCCGGTCTTCAGGGAGGTCGG - Intronic
1020321659 7:6943216-6943238 GTGTTGGTCTTGAGGGACGGCGG + Intergenic
1020690951 7:11353877-11353899 CTGTAAGTTTTGAGGGAGCAAGG + Intergenic
1021486632 7:21175331-21175353 GTGTGGGTCTTGAGAGAGGTGGG - Intergenic
1021523177 7:21556677-21556699 GTGGCCTTCTTGAGGGTGGAGGG - Intronic
1024168343 7:46757951-46757973 GTGTCAGGCTTGTCTGAGGATGG - Intronic
1024445965 7:49479402-49479424 CTGTCATTCTTGAGGGTGGGGGG + Intergenic
1024532389 7:50404667-50404689 GTCCCAGTCTTGAGGGTGGGTGG + Intronic
1027293706 7:76744682-76744704 GTGTCAGTGGTGTGGGGGGAGGG - Intergenic
1027339413 7:77190051-77190073 GTGTCAGTCTTCTAGGAGGCTGG - Intronic
1029110477 7:98211165-98211187 GTGGCTGTCTTGGGGGACGAGGG + Intergenic
1029936977 7:104435586-104435608 GTGTGTTTCTTGAGTGAGGAAGG - Intronic
1030219061 7:107078357-107078379 GTGTCAGTCTTGAGCAAGGGAGG + Intronic
1030703337 7:112665895-112665917 GTGGCAGTCTTCAGGGAAGCTGG - Intergenic
1030909826 7:115233416-115233438 GCTTCAGTCCTCAGGGAGGAAGG - Intergenic
1033036323 7:137879330-137879352 GTGGAAGTGTGGAGGGAGGAGGG + Exonic
1033367016 7:140679359-140679381 GCTTCAGTCTGGAGAGAGGATGG + Intronic
1033581332 7:142739833-142739855 GTGTACGTGTTGGGGGAGGAAGG + Intergenic
1034685816 7:152970380-152970402 GTGTCAGGCTGGTGGGAGCAGGG + Intergenic
1035081365 7:156219233-156219255 GTCTCAGTCTGCAGGGAGCACGG + Intergenic
1035300577 7:157894756-157894778 GCTTCAATCTTGAGGGAGGCAGG - Intronic
1035442119 7:158910488-158910510 GTGTCAGGCCTGTGGGTGGAGGG + Intronic
1035442173 7:158910745-158910767 GTGTCAGACCTGTGGGTGGAGGG + Intronic
1035442194 7:158910840-158910862 GTGTCAGGCCTGTGGGCGGAGGG + Intronic
1035442234 7:158911031-158911053 GTGTCAGGCCTGTGGGCGGAGGG + Intronic
1036374513 8:8188842-8188864 GTGTTTGTCTTGAGGGAAGGCGG - Intergenic
1036855029 8:12234305-12234327 GTGTTTGTCTTGAGGGAAGGCGG + Intergenic
1036876390 8:12476793-12476815 GTGTTTGTCTTGAGGGAAGGCGG + Intergenic
1037108597 8:15139293-15139315 GTATCAGTCATGGGAGAGGACGG + Intronic
1038683671 8:29694958-29694980 GTGTCAGTGATGATGGAGAAAGG - Intergenic
1039094437 8:33868277-33868299 GATTCCGTCTTGATGGAGGATGG - Intergenic
1039250248 8:35656056-35656078 GGGTGACTCTTGAGGGAGGGAGG - Intronic
1039839694 8:41284916-41284938 GTGTCTGACCTGAGGGAAGAAGG - Intronic
1039991691 8:42493428-42493450 GTGACAGTGATGAGGGATGATGG - Intronic
1041349378 8:56933475-56933497 GTTTCAGTCGGGAGGCAGGATGG - Intergenic
1042463135 8:69094315-69094337 GTTTCTGACTTGCGGGAGGAGGG - Intergenic
1044329495 8:90899940-90899962 GTATCAGACTGTAGGGAGGAAGG - Intronic
1045420626 8:102011199-102011221 GTGTCTGTGTTGGGGGAGTAGGG - Intronic
1045857253 8:106778738-106778760 GGGTGAGTCTTCAGGTAGGAAGG + Intergenic
1047092194 8:121586779-121586801 GTGCCAGGTTTGGGGGAGGAGGG - Intergenic
1048749666 8:137657998-137658020 ATCTCAGTGTTGTGGGAGGAAGG - Intergenic
1049791142 8:144473252-144473274 GTGTCGGTGCTGAGGGAAGAAGG - Exonic
1050189755 9:3012442-3012464 CTGCCAGGGTTGAGGGAGGAAGG - Intergenic
1050799950 9:9598214-9598236 GTGTCCACCTTGAGGAAGGAGGG - Intronic
1051571764 9:18566746-18566768 GTGACAGGCCTGAGGGATGATGG + Intronic
1053531252 9:38883841-38883863 GGGTCATACTTGAGGGTGGAGGG + Intergenic
1054203476 9:62108273-62108295 GGGTCATACTTGAGGGTGGAGGG + Intergenic
1054634886 9:67480091-67480113 GGGTCATACTTGAGGGTGGAGGG - Intergenic
1056077807 9:83059604-83059626 GTGTGGGTGTTGAGGGTGGAGGG - Intronic
1056544973 9:87605961-87605983 GTGAGTGCCTTGAGGGAGGAGGG + Intronic
1056657484 9:88521187-88521209 GTGCCTGTGTTGGGGGAGGAGGG + Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057282136 9:93720635-93720657 GTCTCTGTCAGGAGGGAGGAGGG - Intergenic
1059764375 9:117370041-117370063 GTGGCAGTGTGGAGGGAGGTGGG - Intronic
1060042097 9:120308638-120308660 CTGTGCCTCTTGAGGGAGGAAGG + Intergenic
1061043305 9:128151716-128151738 GAGTGAGTCTTGAGTGAGGTGGG + Exonic
1061592715 9:131608422-131608444 GTCTCAGTTTTGAGTGTGGATGG + Intronic
1186645798 X:11506107-11506129 GTGGGAGACTTCAGGGAGGAGGG - Intronic
1189646686 X:43140395-43140417 GTGTGTGTCTTTAGGGTGGAAGG - Intergenic
1191140563 X:57112089-57112111 GTGGCATACTTGAGGGTGGAGGG + Intergenic
1191896023 X:65994307-65994329 GTGTCAGTTATGAGGTAGGGTGG - Intergenic
1192267438 X:69548517-69548539 GACTGAGTATTGAGGGAGGAAGG + Intergenic
1195133417 X:101877685-101877707 GTGTGTGTGTTGAGGGAGGGCGG - Intergenic
1197539522 X:127739941-127739963 TTGTCAGGGTTTAGGGAGGAAGG + Intergenic
1198068263 X:133121603-133121625 GAGTCAGTCTGGAGGGACCAGGG + Intergenic
1198126857 X:133653408-133653430 TTGTCATTCTGGAAGGAGGAAGG + Intronic
1199907853 X:152252905-152252927 GTGTCAGCTCTGAGAGAGGATGG - Intronic