ID: 933878994

View in Genome Browser
Species Human (GRCh38)
Location 2:86649067-86649089
Sequence TAGGGAGGTAGAGCTGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 1, 2: 0, 3: 18, 4: 259}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933878987_933878994 16 Left 933878987 2:86649028-86649050 CCCAGATTGCTGTGTGAAGAAAA 0: 1
1: 0
2: 3
3: 19
4: 344
Right 933878994 2:86649067-86649089 TAGGGAGGTAGAGCTGATGCAGG 0: 1
1: 1
2: 0
3: 18
4: 259
933878988_933878994 15 Left 933878988 2:86649029-86649051 CCAGATTGCTGTGTGAAGAAAAT 0: 1
1: 0
2: 2
3: 23
4: 264
Right 933878994 2:86649067-86649089 TAGGGAGGTAGAGCTGATGCAGG 0: 1
1: 1
2: 0
3: 18
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933878994 Original CRISPR TAGGGAGGTAGAGCTGATGC AGG Intronic
900725225 1:4212079-4212101 TCTGGAAGTAGAGCTGCTGCAGG + Intergenic
901115527 1:6840801-6840823 CAGGGAGGCAGTGCTGAGGCAGG + Intronic
901237512 1:7675466-7675488 TAGGGAGGAAGAACAGAAGCAGG + Intronic
902082828 1:13833017-13833039 AACAGAGGTAGAGATGATGCTGG + Intergenic
902238058 1:15070372-15070394 GAGGAAGGGAGAGCTGGTGCTGG - Intronic
902565206 1:17306885-17306907 TAGGGATGTTGAGATGAGGCAGG + Intergenic
904869009 1:33604911-33604933 TAGAGAGGTAGAGTTAATCCAGG - Intronic
904922911 1:34022730-34022752 GATGGAGGTAGGGCTCATGCCGG + Intronic
905279350 1:36839022-36839044 TAGGGAGATCAGGCTGATGCTGG + Intronic
905461714 1:38126576-38126598 CAGGGAAGTAGAGCTGGGGCTGG + Intergenic
906089973 1:43170815-43170837 TAGGGACTTTGAGCTGATGGAGG + Exonic
906679958 1:47719834-47719856 TTGAGGGGTAGAGCAGATGCTGG + Intergenic
908351773 1:63292954-63292976 GTAGGAAGTAGAGCTGATGCTGG - Intergenic
909609757 1:77539732-77539754 AAGGGAGATTAAGCTGATGCAGG - Intronic
913457668 1:119049908-119049930 TAGGGAGCTAGAGTGGAAGCAGG - Intronic
914770361 1:150678573-150678595 TATGCAGAGAGAGCTGATGCTGG + Intronic
915079021 1:153338582-153338604 GAGTGTGGTAGAGCTGATGCTGG - Intronic
915414084 1:155726586-155726608 TAGGAAAGTAAAGCTGAGGCCGG - Intronic
916379617 1:164195443-164195465 CATGGAGGTTGAGCTGAAGCGGG + Intergenic
917169186 1:172150823-172150845 TATGCAGGTAGGGCTGCTGCGGG + Intronic
920002466 1:202809059-202809081 TTGGGAGGTGGAGATGTTGCAGG + Exonic
922617282 1:226968665-226968687 CAGGGAGGTAGGGCTGCTGCAGG + Intronic
924388684 1:243526383-243526405 GGAGGAGGTGGAGCTGATGCAGG + Intronic
1063635319 10:7776806-7776828 TTGGGAGGTCGAGCTCAGGCAGG + Intronic
1063811449 10:9713479-9713501 TAGGGAGATAGGGCTGTTTCTGG + Intergenic
1064229463 10:13517311-13517333 TAAGGAAGGAGAGCTGCTGCAGG + Intronic
1064676506 10:17765386-17765408 TTGGGACTTAGAGTTGATGCTGG - Intronic
1065137298 10:22684632-22684654 CAGGGAGCTCGAGCTGATACTGG - Intronic
1067381012 10:45773424-45773446 TAGGTATGAAGAGCTGATTCGGG - Intronic
1067451220 10:46383236-46383258 TAAGGAGGGAGAGCTGAGACAGG + Intronic
1067586022 10:47476515-47476537 TAAGGAGGGAGAGCTGAGACAGG - Intronic
1067888711 10:50114063-50114085 TAGGTATGAAGAGCTGATTCGGG - Intronic
1068567501 10:58592295-58592317 TAGGGAGGCAGAGGTGGTGGTGG + Intronic
1069545820 10:69327928-69327950 TGGGGAGGGATAGTTGATGCAGG + Intronic
1070563400 10:77584886-77584908 TAGGGAGCTGGAGGTGATGCTGG - Intronic
1072456805 10:95583498-95583520 TTTGGAGGTGGATCTGATGCTGG + Intergenic
1073022857 10:100461175-100461197 TTGGGAGGTAGAGCAGATTTGGG - Intergenic
1074274668 10:111989895-111989917 TAGGGAGAGAGAGCTTCTGCTGG - Intergenic
1077347758 11:2072000-2072022 GAGCGAGGCAGGGCTGATGCAGG - Intergenic
1080386248 11:31812745-31812767 TAGGGCTGAAGAGCTGAGGCAGG + Intronic
1080575308 11:33593504-33593526 TAGGGATGCAGAGTGGATGCAGG + Intronic
1083777563 11:64901772-64901794 TAGGGAGGCAGCCCTGATGCTGG - Intronic
1084153789 11:67303188-67303210 TAGGGAGGCAGAGCTGAGGTGGG - Intergenic
1085875263 11:80399600-80399622 CAGGGAGGTAAAGCTGACGGAGG + Intergenic
1087454866 11:98372154-98372176 TAGGGATGGGGAGCTGATGGTGG + Intergenic
1089003466 11:115071038-115071060 TGAGGAGGAAGAGCTGATGCGGG + Intergenic
1089793186 11:120958921-120958943 TAGGGCAGAAGAGCTGAGGCAGG + Intronic
1091038140 11:132252263-132252285 TAGGATGGTAGAGCTGATAAAGG - Intronic
1091159949 11:133411096-133411118 CAGGGAGGTCAAGGTGATGCTGG + Intronic
1091232612 11:133998456-133998478 GAGGGAGGTAGAGCTGCCCCTGG + Intergenic
1091753514 12:3037300-3037322 AAGGGAGGGACAGCTGGTGCTGG + Intronic
1093302147 12:17471257-17471279 TAGGGTGGGGGAGCTGAGGCTGG - Intergenic
1094414308 12:30201464-30201486 TGGGGAGGAAGAGGTGCTGCTGG + Intergenic
1096199272 12:49670085-49670107 CAGGGAGTTAGAGCTGAACCTGG - Intronic
1100213862 12:92427443-92427465 TAGGCAGGGAGAGTTGATGGGGG + Intronic
1100661805 12:96707733-96707755 AAGGAAGGTAGAGCTGTTGGGGG + Intronic
1103900335 12:124300536-124300558 TAGGGAGGTAGTGCTGGGGTTGG + Intronic
1104175608 12:126329289-126329311 CAGGCAAGTAGTGCTGATGCAGG - Intergenic
1104857992 12:131910763-131910785 GTGGGAGGTGGAGCTGCTGCTGG - Exonic
1106078377 13:26480297-26480319 AAAGGAGGCAGAGCTGCTGCAGG - Intergenic
1108133277 13:47327221-47327243 TAGGGATGAGGGGCTGATGCAGG + Intergenic
1108418882 13:50228617-50228639 TAGGGCAGTAGGGCTGCTGCAGG - Intronic
1110019156 13:70447384-70447406 AAGGGTGGTAGAGATGAAGCAGG + Intergenic
1111254509 13:85648562-85648584 TAGGTAGGTAGAGCTGAGTGGGG - Intergenic
1112516037 13:100054152-100054174 TTGGGGGGTAGGGCTGAGGCAGG - Intergenic
1113634557 13:111910600-111910622 CAGGGAGGGAGAGCTGGTGGGGG + Intergenic
1114267300 14:21080574-21080596 TGGGGTGGTGGGGCTGATGCTGG + Intronic
1114644841 14:24249589-24249611 TGGGGAGTAAGAGCTGATCCAGG + Intronic
1114924816 14:27383500-27383522 TAGTGAGTTTGAGCTGATGATGG + Intergenic
1116212752 14:41968783-41968805 TACGGAGGGTGAGCTGAAGCAGG - Intergenic
1118155603 14:63238526-63238548 TTGGGAGGTTGAGCTGAGGTGGG - Intronic
1118456687 14:65951361-65951383 TAAGGAGGTAGCGTTGAAGCTGG - Intergenic
1118801972 14:69198559-69198581 TAAGGAAATAGAGATGATGCTGG - Intronic
1118830004 14:69421981-69422003 CAGGGAGGGTGAGCTGAAGCAGG - Intronic
1118960167 14:70522734-70522756 TATGGAGGTAGTGCTGATAGTGG - Exonic
1119219688 14:72896034-72896056 TAGGTAGTTAGAGATTATGCTGG - Intergenic
1121814718 14:96920454-96920476 TAGGAAGGTGGAGCTGGGGCTGG + Intronic
1122305301 14:100762190-100762212 AAGGGAGGAAGTGCTGATGCAGG + Intergenic
1123433402 15:20237302-20237324 TTTGGAGGTAGAGCTGATGGGGG - Intergenic
1124258084 15:28162253-28162275 CCGGGAGGTAGAGGTGATCCTGG + Intronic
1125219820 15:37320102-37320124 CATGGAGGGAGAGCTGAAGCAGG + Intergenic
1129274609 15:74436720-74436742 GAGGGAGGAAGAAATGATGCAGG + Intergenic
1129333706 15:74840323-74840345 AAGGGAGGCAGAGCGGAGGCTGG + Intronic
1130089498 15:80808253-80808275 CAAGGAGGCAGACCTGATGCTGG + Intronic
1130672857 15:85928248-85928270 TAGGGACTTAGGGCTGATTCTGG + Intergenic
1130830023 15:87589927-87589949 CAGGGTGGTTGAGTTGATGCTGG - Intergenic
1131025470 15:89137858-89137880 TGGGGAGGTAAGGCTGAGGCTGG - Intronic
1202982782 15_KI270727v1_random:380309-380331 TAGAGAGGTAGAGCCGATATGGG - Intergenic
1132763602 16:1523529-1523551 GAGGGCGGTAGAGCTGCTGCTGG - Exonic
1133502608 16:6379971-6379993 AAGGGAGAGAGAGCAGATGCAGG + Intronic
1133634698 16:7653978-7654000 TGGGGAGGGAGGGCTGGTGCAGG - Intronic
1135663338 16:24315407-24315429 GAGGGAGGGAGAGATGATGATGG - Intronic
1136851223 16:33613826-33613848 TTTGGAGGTAGAGCTGATGGGGG + Intergenic
1137641283 16:50032532-50032554 CAGGGAGGAAGGGGTGATGCTGG + Intronic
1137828038 16:51516771-51516793 TATGGAGAGAGAGCAGATGCAGG + Intergenic
1139391264 16:66607252-66607274 TAGGTGGGAAGAGCTGATGCAGG - Intronic
1139706400 16:68743683-68743705 AAAGGAGATAGAGCTGAGGCAGG - Intronic
1139751920 16:69114140-69114162 TAGGGAGGTAGAGCTGGTGCTGG + Intronic
1140691849 16:77492145-77492167 TGGGGAGGCAAAGGTGATGCAGG + Intergenic
1141197063 16:81868009-81868031 TAGTGAGGTTCAGCTGAAGCGGG - Intronic
1203112827 16_KI270728v1_random:1462287-1462309 TTTGGAGGTAGAGCTGATGGGGG + Intergenic
1142564740 17:832721-832743 TAGGGAGGGAGGGAAGATGCAGG - Intronic
1144671611 17:17135942-17135964 TAAGGAGCTACAGATGATGCTGG + Intronic
1144726258 17:17504157-17504179 TATGGAGGTAGAGTGGATGATGG - Intergenic
1145797723 17:27665660-27665682 CAGGGAGGCACAGCTGTTGCTGG - Intergenic
1146156808 17:30531114-30531136 TGGGGTGGGAGAGCTGAAGCTGG - Intergenic
1146619981 17:34389617-34389639 TGGGGAGGCAGAGCTGCTGTAGG + Intergenic
1146709069 17:35025091-35025113 TAGGGAGGCAGAGATGAAGAAGG - Intronic
1148080289 17:44964184-44964206 TAGGGAGGCAGAGCTGAATCTGG - Intronic
1148432673 17:47654982-47655004 TAGTTGGGTAGAGCTGATGGGGG + Intronic
1149723133 17:58865462-58865484 TGGGGAGGCAGAGGTGAGGCGGG + Intronic
1149941289 17:60870246-60870268 GAGGAAGGTAGAGCTTATTCGGG + Intronic
1151647451 17:75443015-75443037 TAGGGAGCTAGAGAAGAAGCAGG + Intronic
1151681980 17:75627133-75627155 GAGGGTGGTGGAGCTGCTGCTGG - Exonic
1151767711 17:76140715-76140737 GAGGGAGGCAGATCTGATGGGGG - Intronic
1152647559 17:81476582-81476604 TGGAAAGGAAGAGCTGATGCTGG - Intergenic
1152755311 17:82084726-82084748 CAGGGAGGTGGGGCTGCTGCGGG + Intronic
1155439052 18:25842379-25842401 TAGGGAGGAGGTGCTGAAGCCGG - Intergenic
1156148949 18:34222043-34222065 TAGGATGGCAGATCTGATGCAGG - Intronic
1156464307 18:37339035-37339057 TTGACAGGCAGAGCTGATGCGGG + Intronic
1156590006 18:38476099-38476121 TATGGAGGTAGAGAAGATGGAGG + Intergenic
1158714566 18:59866548-59866570 TTGGGAGGCAGAGGTGATGGGGG - Intergenic
1159629080 18:70728253-70728275 TAGGAAGGAACAGGTGATGCAGG - Intergenic
1162086664 19:8253569-8253591 TTGGGAGGCTGAGCTGAGGCAGG - Intronic
1162761586 19:12891748-12891770 TTGGGGGGTAGGGCTGATGAGGG + Intronic
1165029605 19:32988362-32988384 TTTGGAGGTAGAGCTGATGGGGG - Intronic
1166841562 19:45700500-45700522 TAGGGAGGTAGAGGAAAGGCTGG - Intronic
1167980660 19:53272553-53272575 TGGGGAGGTAGAGATAATGAGGG + Intergenic
924963610 2:56898-56920 TGGGGAGGTGGAGCTGGGGCTGG + Intergenic
925043183 2:749770-749792 GAGGGAGGTGCAGCTGATGAAGG + Intergenic
925411505 2:3642499-3642521 TAGGGAGGGAGGGATGAAGCCGG - Intronic
927360025 2:22222352-22222374 TTAGGAGTTAGAGTTGATGCTGG + Intergenic
927372569 2:22373796-22373818 TAGGGATATAGAGCCGAGGCTGG - Intergenic
927445788 2:23160425-23160447 GAAGGAGGAAGAGCTGAGGCAGG + Intergenic
927879045 2:26677611-26677633 TGGGAAGGGAGAGCAGATGCTGG - Intergenic
927888187 2:26731123-26731145 TAGGCAGGAAGAGCTGAGGGAGG - Exonic
931499195 2:62845459-62845481 TAAGGAGCTAGAGTTGATGATGG + Intronic
932067630 2:68583266-68583288 TAGGGTAGTAAAGCTGTTGCAGG - Intronic
933596580 2:84288967-84288989 AAGGGAGGCTGTGCTGATGCTGG + Intergenic
933878994 2:86649067-86649089 TAGGGAGGTAGAGCTGATGCAGG + Intronic
934106353 2:88698592-88698614 TAGGGAGGTAGAGGAGAGGGAGG + Intronic
934129286 2:88931914-88931936 TGGGCAGGGAGAGCAGATGCTGG + Intergenic
936992853 2:118384323-118384345 TAGGTAGGTAAGGCTAATGCAGG - Intergenic
942122480 2:172792136-172792158 CCGGGAGGCAGAGCTGGTGCTGG - Intronic
945001399 2:205354823-205354845 GAGGGAGGTAAACCTTATGCAGG + Intronic
945494944 2:210498836-210498858 TAGGGCGGGAGAGCTCAGGCTGG + Intronic
946558951 2:220891081-220891103 TAGGGAGGAAATGCTGAGGCAGG + Intergenic
947493956 2:230619399-230619421 CATGGAGGGTGAGCTGATGCAGG + Intergenic
947745319 2:232504166-232504188 TGGGGAGGCAGAGCTGCCGCGGG + Intergenic
948315483 2:237025474-237025496 AGGGGAGCTAGATCTGATGCAGG + Intergenic
948771149 2:240251827-240251849 GAGGGAGGGAGAGCTGGGGCGGG - Intergenic
1170464718 20:16612090-16612112 CCTGGAGATAGAGCTGATGCTGG + Intergenic
1174280725 20:49437290-49437312 TAAGGAGGGAGAACTGATGGGGG + Intronic
1176552860 21:8236509-8236531 TAGGGAGGGAGGCCTGAGGCGGG - Intergenic
1176554178 21:8246319-8246341 TCGGGAGGCCGAGCTGAGGCAGG + Intergenic
1176571758 21:8418912-8418934 TAGGGAGGGAGGCCTGAGGCGGG - Intergenic
1176573100 21:8429343-8429365 TCGGGAGGCCGAGCTGAGGCAGG + Intergenic
1176579669 21:8463474-8463496 TAGGGAGGGAGGCCTGAGGCGGG - Intergenic
1180030918 21:45207003-45207025 CAAGGAGGCAGAGCTGACGCAGG - Intronic
1181676392 22:24456427-24456449 GAGGGAGGTGGAGCTGGTGAAGG + Intergenic
1183489703 22:38109800-38109822 GAGGGAGGAAGAGGTGCTGCTGG - Intronic
1183830368 22:40415698-40415720 GAAGGAGGTAGGGCAGATGCTGG - Intronic
1185276833 22:49953540-49953562 TAGGGAAGTGGACCTGAGGCCGG + Intergenic
1203257837 22_KI270733v1_random:152909-152931 TAGGGAGGGAGGCCTGAGGCGGG - Intergenic
1203259184 22_KI270733v1_random:163359-163381 TCGGGAGGCCGAGCTGAGGCAGG + Intergenic
949429065 3:3953301-3953323 TTGGGAGGCTGAGCTGAGGCAGG + Intronic
950222491 3:11206892-11206914 TAGGGTGGGAGAGCTGAGGAGGG + Intronic
951833828 3:26959664-26959686 CATGGAGGGAGAGCTGAAGCAGG - Intergenic
951835035 3:26973650-26973672 TAGAGAAGGAGATCTGATGCTGG - Intergenic
952216102 3:31279248-31279270 TAGGGAGTTAGAGGGGTTGCGGG - Intergenic
953931012 3:47005656-47005678 TAGGGATGGAGAGCAGATGGTGG + Intronic
954411630 3:50373696-50373718 GAGGGAGATAGAGGAGATGCAGG + Intronic
954699419 3:52443546-52443568 TAGGGAGGTGGAGGTAATGGGGG + Intronic
956158330 3:66321615-66321637 TAGGGAAGTACAGATGAAGCAGG + Intronic
956167912 3:66410190-66410212 TGCTGAGGTGGAGCTGATGCAGG + Exonic
957927413 3:86832584-86832606 TGGGGAGCTAGGGCTGCTGCTGG - Intergenic
958975961 3:100668083-100668105 CATGGAGGGAGAGCTGAAGCAGG - Intronic
960047274 3:113210904-113210926 TGGGGAGGGAGAGCTGGGGCTGG - Intergenic
961787784 3:129357947-129357969 CAGGGAGGTGGAGGTGAGGCCGG + Intergenic
962137172 3:132747150-132747172 TATGGAGGGTGAGCTGAAGCAGG - Intergenic
962628141 3:137248167-137248189 CAGGGAGGTGGGGCTGCTGCTGG + Intergenic
963704690 3:148671135-148671157 TAGGAAGGTAGAGAAGCTGCTGG + Intergenic
964195190 3:154056174-154056196 TAGGGAGTTTCAGCTAATGCAGG + Intergenic
964790628 3:160450614-160450636 TAGGGAGTTAGAGGTGAAGTAGG - Intronic
964943718 3:162191727-162191749 AAGGGAGAGAGAGCTCATGCAGG - Intergenic
968416814 4:444700-444722 TGGGGAGGAAGAGCTGTTGGTGG - Intronic
969951032 4:10835732-10835754 GAAGGAGGTAGGGCTTATGCTGG + Intergenic
970617638 4:17782187-17782209 TAGGGAGGTAGAAAGGATGGTGG + Intergenic
975102854 4:70534351-70534373 TAGGGAGGAAGATATGGTGCTGG - Intergenic
976394821 4:84544794-84544816 TACGGAGGGCGAGCTGAAGCAGG + Intergenic
976705718 4:88016852-88016874 TTGGGAGGCTGAGCTGAGGCAGG + Intronic
977406926 4:96611286-96611308 TAGGAAGATAGATCTGATGATGG + Intergenic
979931680 4:126640203-126640225 TGGGGAGGCTGAGCTGAGGCAGG - Intergenic
980119107 4:128709423-128709445 CAGGGAGGAAGAGGTGTTGCTGG + Intergenic
980584003 4:134789390-134789412 CAGGGAGGGTGAGCTGAAGCAGG + Intergenic
981178251 4:141707972-141707994 TGGAGAGGCAGAGCTGCTGCAGG + Intronic
981808296 4:148742229-148742251 TAGGGAAGTATAGTAGATGCGGG + Intergenic
982901420 4:161008729-161008751 TAAAGAGTTAGAGCAGATGCTGG - Intergenic
985588556 5:753213-753235 GAGGGAGGCCGAGCTGATGGCGG - Intronic
985603223 5:845652-845674 GAGGGAGGCCGAGCTGATGGCGG - Intronic
986221433 5:5772131-5772153 TAGGGAGGCAGAGCTCAGTCGGG + Intergenic
990230340 5:53706155-53706177 CATGGAGGTTGAGCTGAAGCAGG - Intergenic
993952732 5:94196239-94196261 CAGGGGAGTAGAGCTGATACAGG - Intronic
994353681 5:98773187-98773209 CAAGGAGGTGGAGCTGAAGCTGG + Intronic
995443108 5:112213593-112213615 TTGGGAGGCTGAGGTGATGCGGG - Intronic
998514423 5:142739843-142739865 TAGGGAGGTGTAGGTGCTGCTGG - Intergenic
999199859 5:149808263-149808285 TTGGGAGGTGGAGCTGGGGCTGG - Intronic
999944661 5:156581898-156581920 TATGGAGGGTGAGCTGAAGCAGG - Intronic
1000035428 5:157444087-157444109 TATGGAGGTAGGGCTGAGGCAGG + Intronic
1000978297 5:167788979-167789001 TAGTGGGGTAGAGCTGCAGCAGG - Intronic
1002465315 5:179405463-179405485 TAGGGAGGCCGAGCTGGTCCTGG - Intergenic
1006597130 6:35201698-35201720 TGGGGAGGGAGTGCTGCTGCTGG + Intergenic
1007757724 6:44111261-44111283 TAGGGAGGAAGAGCAGTTGTGGG - Intergenic
1008332243 6:50259306-50259328 TCGGGAGGCTGAGCTGAGGCAGG + Intergenic
1008428259 6:51384246-51384268 GTGGGAGGTAGAGTTGTTGCTGG - Intergenic
1011559972 6:88604253-88604275 TAAGAAGGAAGAGCTGATGTGGG - Intergenic
1013994910 6:116296949-116296971 TAGGGAGGAAGAGTTGAGGCAGG + Intronic
1014982714 6:127964405-127964427 CAGGAAGGTAGTGCTGCTGCAGG + Intergenic
1015667930 6:135652477-135652499 GAGGGGGGCAGAGCTGAGGCAGG - Intergenic
1016065713 6:139681071-139681093 GAGGGAGGTGGAGGAGATGCCGG - Intergenic
1018370414 6:163162936-163162958 CAGGGAGGTGGAGCTGCTGTAGG + Intronic
1018932439 6:168250152-168250174 TAGGTAGGTAGAGCAGGTTCTGG - Intergenic
1018967704 6:168501498-168501520 TAGCGAGGGACAGATGATGCAGG - Intronic
1021476825 7:21071373-21071395 TGGGGAGGTGGAGAGGATGCTGG + Intergenic
1022487298 7:30789540-30789562 AAGGGAGCTGGAGCTGCTGCAGG - Intronic
1023176532 7:37440907-37440929 TTGGGAGGTAGAGCTAGTGGAGG - Intronic
1023561102 7:41474152-41474174 AAGGGAGGTGGAGCAGATGTAGG - Intergenic
1024453552 7:49577750-49577772 TAAGTAAGTACAGCTGATGCAGG - Intergenic
1024674975 7:51630233-51630255 TAGGGCCATGGAGCTGATGCAGG + Intergenic
1027723074 7:81769582-81769604 TAGGGAGGAAGTGCTAATACTGG - Intronic
1028343269 7:89748367-89748389 TAGGGTGGGAGAGCTGTTGGGGG + Intergenic
1032610588 7:133408280-133408302 TAGGGTGGTAGTGATGATGGAGG + Intronic
1032656528 7:133936569-133936591 TGGGTAAGCAGAGCTGATGCTGG - Intronic
1032740211 7:134730949-134730971 AAAGGAGGTAGACCAGATGCTGG - Intergenic
1032965666 7:137094023-137094045 TAGAGAGGTAGAGGTGTTCCGGG - Intergenic
1033604362 7:142915028-142915050 CAGGGAGGCATAGGTGATGCTGG + Exonic
1033774253 7:144589196-144589218 CAGATAGGTAGAGCTGAAGCGGG + Intronic
1033870895 7:145752221-145752243 AAGGGAGGCACAGGTGATGCTGG - Intergenic
1034400182 7:150856953-150856975 TATTGAGGAAGAACTGATGCAGG - Exonic
1034535705 7:151724541-151724563 TTGGAGGGTAGAGCTGGTGCTGG + Intronic
1036649084 8:10630627-10630649 TAGGGAGGCAGAGCCCAGGCAGG - Intronic
1037393158 8:18415990-18416012 TTGGGACTTAGAGTTGATGCTGG - Intergenic
1040354927 8:46608290-46608312 CATGGAGGGAGAGCTGAAGCAGG + Intergenic
1041838725 8:62246058-62246080 TGGGAAGGGAGAGCAGATGCAGG - Intergenic
1042430428 8:68700248-68700270 TGGGGAGGTAGAGCTGTGTCTGG + Intronic
1042510493 8:69606231-69606253 TAGGGAGGGAGAGCTGTTGAAGG + Intronic
1043482625 8:80668546-80668568 AAGGCAGGTTGAGCTGCTGCTGG + Intronic
1044939049 8:97321899-97321921 TATTGAGGTGGAGCTGATGCTGG + Intergenic
1045294256 8:100860226-100860248 TAAGGAGGTGAAGCTGCTGCAGG + Intergenic
1045975187 8:108123325-108123347 CATGGAGGGAGAGCTGAAGCAGG - Intergenic
1048512244 8:135073324-135073346 AAAGGAGGGAGGGCTGATGCGGG - Intergenic
1048816559 8:138339870-138339892 TGGAGAGGAAGAGCTGATGGGGG + Intronic
1050255937 9:3792053-3792075 CAGGAAGGCATAGCTGATGCTGG + Intergenic
1050320660 9:4448986-4449008 TATGGAGGGTGAGCTGAAGCAGG + Intergenic
1051614574 9:18994865-18994887 TTGGGATGTAGAGGAGATGCTGG - Intronic
1053598581 9:39587566-39587588 TAAGGAGGAAGATCTCATGCTGG - Intergenic
1056167865 9:83956392-83956414 GAGGGTGGCAGAGCTGCTGCTGG - Exonic
1058907685 9:109495144-109495166 TTGGAATGAAGAGCTGATGCTGG + Intronic
1058914899 9:109556312-109556334 TAGGGAGGTAGAACTGGGACAGG - Intergenic
1059513268 9:114869514-114869536 TACGGAGGGCGAGCTGAAGCAGG + Intergenic
1060048186 9:120357701-120357723 AAGGGTGGTGGGGCTGATGCAGG - Intergenic
1060474006 9:123971483-123971505 AGGGGAGGTAGAGGTGAGGCAGG + Intergenic
1060739830 9:126090950-126090972 GAGGGAGGAAGCGCTGAGGCAGG + Intergenic
1062202328 9:135310057-135310079 CAGGGAGGAAGAGCTGCAGCGGG + Intergenic
1062445161 9:136590589-136590611 TGGGGAGGCAGAGATGATGGAGG - Intergenic
1203474030 Un_GL000220v1:134932-134954 TAGGGAGGGAGGCCTGAGGCGGG - Intergenic
1203475373 Un_GL000220v1:145402-145424 TCGGGAGGCCGAGCTGAGGCAGG + Intergenic
1186079102 X:5911348-5911370 TAGGGAGGAAGAGTTTATGGTGG - Intronic
1186566762 X:10671603-10671625 TGGGGAGGTAGAGAGGATGGGGG - Intronic
1187790246 X:22942525-22942547 TAGGAAGGGAGAGGAGATGCTGG - Intergenic
1188315707 X:28670581-28670603 GAGGGTGGTAGAGCTGTGGCAGG - Intronic
1189029202 X:37432555-37432577 TAGGAAGGAAAAGGTGATGCCGG - Intronic
1190058178 X:47194149-47194171 TAGGGAGGGGGAGCGGATCCTGG + Intronic
1191084252 X:56547359-56547381 TATGGAGGGTGAGCTGAAGCAGG + Intergenic
1193871120 X:86799529-86799551 CATGGAGGGAGAGCTGAAGCAGG + Intronic
1194117419 X:89920440-89920462 TAAGGAGTCAGAGTTGATGCTGG + Intergenic
1196058076 X:111377588-111377610 GTGGTAGGTAGAGCAGATGCAGG - Intronic
1196198552 X:112860188-112860210 GAGGGAGGGAGGGCTGATGGTGG - Intergenic
1200470209 Y:3577583-3577605 TAAGGAGTCAGAGTTGATGCTGG + Intergenic