ID: 933881302

View in Genome Browser
Species Human (GRCh38)
Location 2:86672739-86672761
Sequence GGAATGGTGTGGATTCCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 271}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933881302 Original CRISPR GGAATGGTGTGGATTCCAGG TGG Intronic
900677630 1:3898381-3898403 GGAATGGCTGGGATTACAGGAGG - Intronic
900745926 1:4360741-4360763 GGACCGGTGTGGCTTGCAGGAGG - Intergenic
901847590 1:11993644-11993666 AGAATGGTGTGAACCCCAGGGGG + Intronic
902446055 1:16465280-16465302 TGGAGGGTGTGGATACCAGGAGG + Intergenic
902572937 1:17358476-17358498 AGAATGGCGTGAACTCCAGGGGG + Intronic
903066465 1:20702430-20702452 AGAATGGTGAGGGTACCAGGAGG - Intronic
903395733 1:23000593-23000615 GAAATGGAGTGAATGCCAGGTGG + Intergenic
904171303 1:28593594-28593616 GGCATTCTGTGGATCCCAGGGGG + Intronic
904569317 1:31449493-31449515 TGGATGGAGTGGGTTCCAGGAGG + Intergenic
904713968 1:32452766-32452788 AGAATGGCGTGAATCCCAGGGGG + Intergenic
904984629 1:34534793-34534815 AGAAGGGTGTGAATTCCAGGAGG - Intergenic
908859319 1:68465220-68465242 GGAAAGGAGTGGTTTCCTGGTGG + Intergenic
910035016 1:82778765-82778787 GAAATGGTGAGCATTCCAGACGG + Intergenic
910161673 1:84278627-84278649 GCAATGGAATGGATTCCAAGGGG + Intergenic
911045379 1:93623303-93623325 GGAATGGTATAGATAGCAGGTGG + Intronic
912427059 1:109603341-109603363 GGAATGGTGAGGATTAGAAGAGG + Exonic
912962261 1:114206827-114206849 AGAAAGGTGTGAATTCCAGGAGG + Intergenic
913211982 1:116589674-116589696 GGAAGGGTATGGAGCCCAGGGGG - Intronic
914306945 1:146428468-146428490 AGAATGGCGTGAACTCCAGGGGG + Intergenic
915450785 1:156003548-156003570 GGCTTGTTGTGGATACCAGGCGG + Intronic
915912092 1:159921850-159921872 GGCATGGTATGGATGCCAAGGGG + Intronic
916932703 1:169595784-169595806 GGATTGGTGTGGATTTCATAAGG + Intronic
917147650 1:171909942-171909964 GGAATACTCTGGATGCCAGGGGG + Intronic
918168553 1:181974054-181974076 GTAATGCTGGGGATTTCAGGGGG + Intergenic
918214006 1:182377128-182377150 AGAATGGTGTCAATTCCTGGAGG + Intergenic
919081055 1:192866285-192866307 GGAATAGTGTGGATTGTAGGAGG - Intergenic
920747010 1:208638387-208638409 GGACTGGGTTGGAATCCAGGTGG - Intergenic
921022525 1:211249254-211249276 GAAATGGTGACTATTCCAGGAGG + Intergenic
921625602 1:217374797-217374819 GGGAAGGTGTGGACTCCAGGTGG - Intergenic
923203285 1:231733332-231733354 GGAATGGTGGTGATTGCAGTAGG + Intronic
1065481245 10:26195873-26195895 GGATTGGTGTGGCTTCCACGAGG + Intronic
1066541392 10:36450461-36450483 GGAATGATTTGGATTCCAATCGG + Intergenic
1067841753 10:49686582-49686604 GGAAAGGAATGCATTCCAGGGGG + Intronic
1069523908 10:69150484-69150506 AGAATGGTGTGAAACCCAGGAGG - Intronic
1069717633 10:70531169-70531191 GGGATGGTGTGGGGTGCAGGAGG + Intronic
1070966135 10:80532188-80532210 GCAAGGGTGTGAGTTCCAGGAGG + Exonic
1071040870 10:81308047-81308069 AGAATGGTGTGAACCCCAGGGGG - Intergenic
1071364973 10:84890152-84890174 AGAATGGCGTGAATTCCCGGGGG + Intergenic
1071720997 10:88145971-88145993 GGATTTGAGTGGAATCCAGGCGG + Intergenic
1073014310 10:100385812-100385834 GAAATGGAGTGAATGCCAGGTGG - Intergenic
1074968270 10:118512857-118512879 AGAATGGCGTGAATCCCAGGAGG + Intergenic
1075414089 10:122249673-122249695 GGAGGGGTGTGGCCTCCAGGTGG + Intronic
1075431343 10:122384517-122384539 AGAATGGTGTGAACCCCAGGGGG + Intronic
1075968023 10:126629718-126629740 TGAATGTTTTGTATTCCAGGTGG + Intronic
1077439431 11:2561111-2561133 AGAATGGTGTGAACCCCAGGGGG + Intronic
1078456214 11:11477495-11477517 GGAAAGGTGTGGAGGGCAGGAGG - Intronic
1082671531 11:56041742-56041764 GGGCTGATGTTGATTCCAGGGGG + Intergenic
1083854452 11:65385882-65385904 AGAATGGTGTGAACCCCAGGGGG - Intergenic
1084043235 11:66554797-66554819 GGAATGGAATTGAATCCAGGAGG + Intronic
1085673798 11:78495393-78495415 GGAATGGTAAGGATTCAAAGGGG - Intronic
1086819026 11:91412079-91412101 GGAATGGCGTGAACCCCAGGGGG - Intergenic
1088972533 11:114786615-114786637 GAATTATTGTGGATTCCAGGTGG + Intergenic
1089272213 11:117309347-117309369 GGCATGGTGGGGATGCCATGGGG - Intronic
1089696894 11:120221399-120221421 GGAGTGGAGTAGATTTCAGGTGG + Intronic
1090888149 11:130897620-130897642 GGATTGGTGTGGAGTCCTGATGG - Intronic
1092460102 12:8678787-8678809 GAAATGGCATGGATTCCAGCTGG + Intergenic
1092728591 12:11507939-11507961 GGAAGGGTGTGGACATCAGGAGG - Intergenic
1095095318 12:38144682-38144704 GGATGGGAGTGGATTTCAGGAGG - Intergenic
1095373971 12:41504342-41504364 GGAAGGGTGTGGGTTCCTGCAGG + Intronic
1095869073 12:47005799-47005821 AGAATGGTGTGATTTCTAGGAGG + Intergenic
1096501204 12:52064715-52064737 GGAAGGGGGTTGATTCCAGGAGG - Intergenic
1096722748 12:53536101-53536123 GGAATGGTGTGGATTGGAAAGGG - Intronic
1097670111 12:62525993-62526015 GGAATGGTGGGGATTGGTGGAGG + Exonic
1102766450 12:115437572-115437594 GGGAGGGTGTGGATGGCAGGCGG + Intergenic
1103312772 12:120025137-120025159 AGAATGGTGTGAACCCCAGGGGG - Intronic
1103465301 12:121137765-121137787 GGACTGGTGTGGACCACAGGTGG + Intronic
1103709512 12:122901305-122901327 AGAATGGTGTGAACCCCAGGGGG - Intergenic
1103939627 12:124494766-124494788 GGATTGGGGTGGCTTCCAGGGGG - Intronic
1104143577 12:126010733-126010755 GGTGTTGTGGGGATTCCAGGTGG + Intergenic
1105215228 13:18280300-18280322 GGAAGGGTATGGAGCCCAGGGGG - Intergenic
1106115711 13:26815948-26815970 GGGAAGGTGTGGATGCCAGGTGG + Intergenic
1106469680 13:30043299-30043321 AGAAGGGTGTGAATGCCAGGAGG - Intergenic
1106600670 13:31183774-31183796 GCAGTGGTGTGGAGTGCAGGTGG - Intergenic
1107196379 13:37657249-37657271 GGAATGCTGTGCATTCTACGAGG + Intronic
1107563715 13:41581087-41581109 AGAATGGCGTGAACTCCAGGGGG - Intronic
1107895302 13:44956052-44956074 AGAATGGTGTGAACCCCAGGGGG + Intronic
1109308085 13:60662446-60662468 GGAACTGTGTACATTCCAGGAGG - Intergenic
1112061728 13:95747331-95747353 GGAAGGGTCTGGATTCAAGAAGG + Intronic
1113127886 13:107000334-107000356 GGAAGGGTGAGCATTCCAGGTGG - Intergenic
1115905059 14:38194705-38194727 GAAATGGTGTGAATGTCAGGTGG - Intergenic
1116865135 14:50025669-50025691 GCAAGGGTGTGAATTCCAGGAGG - Intergenic
1117651012 14:57905433-57905455 GCAAGGGTGTGAATACCAGGAGG + Intronic
1119702596 14:76765479-76765501 GGAGTGCAGTGGAGTCCAGGAGG + Intronic
1121193004 14:92046367-92046389 GAAATGGAGTGAATGCCAGGTGG + Exonic
1121351127 14:93173976-93173998 ACATGGGTGTGGATTCCAGGAGG - Intergenic
1121498215 14:94412490-94412512 GGAATGGGATGGGTTGCAGGGGG - Intergenic
1123433703 15:20239404-20239426 TGGATGATGTGGAGTCCAGGAGG + Intergenic
1123693137 15:22855899-22855921 AGAAAGGTGTGAATACCAGGAGG - Intronic
1123830288 15:24129033-24129055 AGAATGGTGTGAACCCCAGGGGG + Intergenic
1126417757 15:48435832-48435854 AGAATGGTGAGTATTCTAGGTGG - Intronic
1131290382 15:91101653-91101675 GGCATGGCGTGGATTTCAGCAGG + Intronic
1131465348 15:92650540-92650562 GGAACGTTGTGGTTTCGAGGTGG + Intronic
1132236680 15:100227354-100227376 GGAATGGGGAGGATTGGAGGGGG - Intronic
1134189711 16:12111696-12111718 TGAATGGTGTGGGTAGCAGGTGG + Intronic
1134376599 16:13681444-13681466 GCATTGGAATGGATTCCAGGAGG - Intergenic
1135151599 16:20011620-20011642 GGAATGGGGAGGACTCCACGTGG + Intergenic
1136850916 16:33611706-33611728 CGGATGATGTGGAGTCCAGGAGG - Intergenic
1138142795 16:54582998-54583020 TGGATGGTGTGGCATCCAGGAGG - Intergenic
1139579158 16:67861945-67861967 GGAAGGGTGGGGATCGCAGGAGG + Intronic
1140446019 16:75028668-75028690 TGAGTGGAGTGGATTCAAGGAGG - Intronic
1140810692 16:78574343-78574365 ACAATGGTGTGAATACCAGGTGG + Intronic
1141890117 16:86920614-86920636 GGAAAAATCTGGATTCCAGGTGG + Intergenic
1142153256 16:88521897-88521919 GGGAGGGTGTGGATACGAGGGGG - Intronic
1142178222 16:88654804-88654826 TGACTGCTGTGGGTTCCAGGTGG - Exonic
1142978844 17:3660066-3660088 GGATTGGCTTGGATCCCAGGTGG - Intronic
1143465847 17:7135773-7135795 AGAATGGTGTGGTCGCCAGGGGG + Intergenic
1143561288 17:7696784-7696806 GCACTGGTGTGGAGTCCAGGAGG + Intronic
1143700668 17:8657630-8657652 TGAATGAAGTGGATTCCAGGAGG - Intergenic
1145118281 17:20232211-20232233 GGAATGGAGGCGGTTCCAGGCGG + Exonic
1145939878 17:28737760-28737782 GGAATGGTGTGGCATCCATGGGG - Intronic
1148346667 17:46908055-46908077 GGAATGTGCTTGATTCCAGGAGG + Intergenic
1148865097 17:50624213-50624235 GGAATGGCTTTGAGTCCAGGGGG + Intronic
1149242072 17:54662765-54662787 GGACTGCTGTGGTTTCCTGGGGG + Intergenic
1149407630 17:56370392-56370414 TTACTGGTGTGAATTCCAGGTGG - Intronic
1151385923 17:73755279-73755301 GGAAGGGTGAGAGTTCCAGGGGG + Intergenic
1151523209 17:74645898-74645920 AGAATGGTGTGAACCCCAGGGGG + Intergenic
1152360561 17:79831421-79831443 GGAAAGGTGTGGCCTGCAGGTGG - Intergenic
1152896432 17:82913993-82914015 GGAATGTTGTGGGTTCTAGTTGG + Intronic
1152896514 17:82914394-82914416 GGCAGGGTGTGGATTGCTGGGGG + Intronic
1154394474 18:13974526-13974548 GGTGTGGTGTGGAAGCCAGGAGG + Intergenic
1154470367 18:14694146-14694168 GAATTGGTGTGGATCCCAGCGGG - Intergenic
1156354465 18:36329398-36329420 GTAAGGGAGTGGGTTCCAGGTGG - Intronic
1156544928 18:37955208-37955230 GGAATGGTGGGGATGGAAGGGGG - Intergenic
1158576546 18:58643512-58643534 GAAATGGAGTGAATGCCAGGTGG + Intergenic
1161695611 19:5765993-5766015 GGAATGGTTTGGAAACCATGTGG - Intronic
1161838966 19:6667233-6667255 GGGGTGGGGTTGATTCCAGGAGG - Intronic
1162217324 19:9147427-9147449 AGAATGGTGTGAAACCCAGGAGG - Intronic
1164003773 19:21131174-21131196 GAAATGGAGTGAATGCCAGGTGG + Intergenic
1165029916 19:32990516-32990538 TGGATGATGTGGAGTCCAGGAGG + Exonic
1165256169 19:34578319-34578341 TGAAAGGTGTGGGTTCCGGGAGG + Intergenic
1165266401 19:34666021-34666043 TGAAAGGTGTGGGCTCCAGGAGG - Intronic
1165274031 19:34733092-34733114 TGAAAGGTGTGGGCTCCAGGAGG - Intergenic
1165317440 19:35065461-35065483 GGAATGGGGTGGGCACCAGGAGG + Intronic
1166368013 19:42286948-42286970 GCAAGGGTGTGGGGTCCAGGTGG + Intronic
1166667472 19:44689622-44689644 GGAGTGGGGAGGAGTCCAGGCGG - Intergenic
1166929848 19:46295988-46296010 GGAGCCGTGTGGATTCCTGGAGG + Intergenic
1167596431 19:50430783-50430805 GGAGTGGGGTGGATTTCAGGCGG - Exonic
925338063 2:3113231-3113253 GGAAGGATGTTGATTCCAGATGG + Intergenic
926001137 2:9333663-9333685 GGAATGGTGTGGATTGAGGCTGG + Intronic
927891755 2:26755157-26755179 GGACTGGGGTGGATTCCGGCTGG - Intergenic
928289584 2:30025706-30025728 AGAATGGCGTGAACTCCAGGGGG - Intergenic
929520599 2:42647065-42647087 AGAATGGCGTGGAACCCAGGAGG + Intronic
929791747 2:45028359-45028381 GGACTGGTGTGAATTCTGGGAGG - Intergenic
932112203 2:69011990-69012012 GAAGGGGTGTGAATTCCAGGAGG + Intergenic
933881302 2:86672739-86672761 GGAATGGTGTGGATTCCAGGTGG + Intronic
934299092 2:91766437-91766459 GGAAGGGTATGGAGCCCAGGGGG + Intergenic
935221620 2:101019981-101020003 AGAATGGTGTGGAACCCGGGAGG + Intronic
935782659 2:106521657-106521679 GGAAAGAGGTGGTTTCCAGGAGG + Intergenic
936029450 2:109059484-109059506 AGAATGGTGTGAATCCCGGGAGG + Intergenic
936407022 2:112214033-112214055 AGAATGGTGTGAACCCCAGGGGG - Exonic
938413699 2:131086974-131086996 AGAATGGTGTGAACCCCAGGGGG + Intronic
938598208 2:132811176-132811198 GGAATGCAGTGGACTCCATGAGG + Intronic
940373252 2:152924799-152924821 GGAAAGGTGTGGCTTCCCAGAGG + Intergenic
940684765 2:156833176-156833198 GGAATGGTGTGTGGTGCAGGTGG + Intergenic
940907389 2:159181383-159181405 AGAATGGTGTGAACCCCAGGGGG - Intronic
942466055 2:176208503-176208525 AGAATGGCGTGAACTCCAGGGGG + Intergenic
942863802 2:180648129-180648151 GGAAAGGTATGGATTGCAGAAGG - Intergenic
943456972 2:188120423-188120445 GGAATGGCGTGAACCCCAGGGGG - Intergenic
943589299 2:189778523-189778545 GGAGTTGTGTAGATTCCTGGAGG + Intronic
944153216 2:196584195-196584217 GAAGTGGTGGGCATTCCAGGTGG + Intronic
944613721 2:201438427-201438449 GGAATTGTGAGGATTAAAGGAGG - Intronic
947623878 2:231607472-231607494 GGCATGATGTGGACTCTAGGAGG - Intergenic
947997285 2:234539068-234539090 ACAATGGTGTGAATACCAGGAGG - Intergenic
948340102 2:237243093-237243115 AGAATGATGTTGATTCCAGAGGG - Intergenic
1171034298 20:21703803-21703825 GGAATGGTTTGGATTAAAGTGGG - Intergenic
1172219794 20:33265863-33265885 ACAAGGGTGTGGATACCAGGAGG + Intergenic
1173119113 20:40272921-40272943 GAAATGGTGTGAATATCAGGTGG - Intergenic
1173406057 20:42766182-42766204 GAGATGGTGTGCATTCCAAGGGG - Intronic
1176425176 21:6544237-6544259 GGCAAGATGTGGAGTCCAGGAGG + Intergenic
1176804124 21:13463720-13463742 GAACTGGTGTGGATCCCAGGGGG + Intergenic
1178013023 21:28308363-28308385 GGATAGGTGTGGTTTCCAAGTGG + Intergenic
1178935782 21:36860342-36860364 GGAGGGGTGTGGCTTCCTGGAGG - Intronic
1179700667 21:43152554-43152576 GGCAAGATGTGGAGTCCAGGAGG + Intergenic
1180965808 22:19787427-19787449 GGAAGGGTGTGGGATCCAGGTGG - Exonic
1181718427 22:24753318-24753340 GGAATTGTGTGAATTGCATGAGG + Intronic
1182074062 22:27482976-27482998 GCAATATTGTGGATTGCAGGAGG + Intergenic
1183636519 22:39066701-39066723 GAAATGGAGTGAATGCCAGGTGG + Intronic
1183647762 22:39136325-39136347 GCATAGGTGTGAATTCCAGGAGG - Intronic
1185297345 22:50060925-50060947 GGACTGGTGTGGATTTCACCTGG + Exonic
1203308555 22_KI270736v1_random:126492-126514 GGAATGGAGTGGAGTTCAGTGGG + Intergenic
950189081 3:10964093-10964115 GCAAGGATGTGGATACCAGGTGG + Intergenic
950334352 3:12181844-12181866 GGGATGGAGTGGTTTCCAGCTGG + Intronic
950521571 3:13500828-13500850 GCTATGGGGAGGATTCCAGGAGG - Intronic
950926740 3:16748226-16748248 GAAATGGGGTGAATGCCAGGTGG - Intergenic
951519742 3:23600226-23600248 GGAAGGGTCTGGAACCCAGGGGG - Intergenic
951663203 3:25093738-25093760 GGAGTGGTCTGCAGTCCAGGTGG - Intergenic
953584457 3:44187106-44187128 GCAAGGGTGTGAATACCAGGAGG - Intergenic
954108762 3:48422863-48422885 GAATTGGTGTGGCTTCCAGCGGG + Exonic
956593843 3:70945395-70945417 GGAAGGGTGTGTCTTCCAAGTGG - Intergenic
959497258 3:107065687-107065709 GCAATTATGTGGATTTCAGGGGG - Intergenic
961558617 3:127713600-127713622 GAAATGGTGTGGATGCTGGGTGG - Intronic
962021966 3:131511195-131511217 GAAATGGAGTGAATGCCAGGTGG + Intergenic
962358518 3:134715474-134715496 GGGATGGTGTTGATGCCAGAAGG + Intronic
962609640 3:137063681-137063703 GCAAGGATGTGAATTCCAGGAGG + Intergenic
965959146 3:174408003-174408025 GGAATGGTGAGAACTCCAAGTGG - Intergenic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
967005065 3:185376121-185376143 GAAATGGAGTGGATGTCAGGTGG + Intronic
967177870 3:186876340-186876362 AGAATGGCGTGAACTCCAGGGGG - Intergenic
968571005 4:1340631-1340653 GGAATGTGGTGGGTTCCAGCTGG - Intergenic
968669366 4:1840576-1840598 AGAATGGTGTGGACCCCGGGGGG + Intronic
968760748 4:2441889-2441911 GACATGGTGTGGCTCCCAGGAGG + Intronic
969228792 4:5815792-5815814 TCAATGGTGTACATTCCAGGGGG - Intronic
969366132 4:6695370-6695392 GGAAGCGTCTGTATTCCAGGGGG - Intronic
969878026 4:10150287-10150309 GGTCTGGTGTGGATTCTATGTGG + Intergenic
971315797 4:25566965-25566987 GGAATGGCGTGAACCCCAGGGGG - Intergenic
974173173 4:58293126-58293148 GAAATGGAGTGAATGCCAGGTGG + Intergenic
974893809 4:67913819-67913841 GGAATGGTATTGATATCAGGTGG - Intronic
978337759 4:107688171-107688193 GGAATGCTGAAGATTTCAGGTGG - Intronic
978711807 4:111791316-111791338 GTAATGGGGAGGACTCCAGGAGG + Intergenic
979311668 4:119211120-119211142 GAAATGGTGTAGGTTCCAGATGG + Intronic
979831093 4:125304337-125304359 GTAATGGTGATGATTTCAGGGGG - Intergenic
981976765 4:150739516-150739538 ATAATGCTGTGGATACCAGGAGG - Intronic
982584850 4:157222829-157222851 GGATTGGTGTGGAGGCCAGAGGG + Intronic
983660666 4:170127919-170127941 AGGCTGGTGTGGGTTCCAGGTGG - Intergenic
984753382 4:183300194-183300216 GGAATGCTGAGGACTCCAGAAGG - Intronic
985078750 4:186243953-186243975 GAAATGGAGTGGATGTCAGGTGG + Intronic
985558177 5:568361-568383 GAAAGGCTGTGGCTTCCAGGAGG - Intergenic
990268031 5:54099775-54099797 TGAATGGTGAGGATTAAAGGAGG - Intronic
993143892 5:84070010-84070032 GGAATGATGTGGATACCAAGGGG + Intronic
994531780 5:100981875-100981897 GGAAAGATGTGGATGCCAAGGGG + Intergenic
996052350 5:118948544-118948566 GAAATGGAGTGAATGCCAGGTGG + Intronic
996723118 5:126648995-126649017 GAAATGGGGTGAATGCCAGGTGG - Intergenic
997165712 5:131658716-131658738 GAAATGGGGTGGCTTTCAGGGGG + Intronic
997200711 5:132008545-132008567 GGAAGAGAGTGGAGTCCAGGAGG - Intronic
997850961 5:137332178-137332200 GGAAGGGTGGGGATCCCAGGAGG - Intronic
1000268112 5:159657602-159657624 GGAAAGGTCTGGTTGCCAGGAGG + Intergenic
1001068261 5:168558247-168558269 AGAATGGTGTGAACCCCAGGGGG - Intronic
1001651385 5:173318535-173318557 GGGATGGTGAGAAATCCAGGTGG + Intronic
1003171178 6:3723213-3723235 GGAATGGTGGGGAGTCAGGGTGG + Exonic
1003322855 6:5067622-5067644 GGAAGGGTGTGAACACCAGGAGG + Intergenic
1004669196 6:17779827-17779849 AGAATGGTGTGAACCCCAGGGGG - Intronic
1005490630 6:26344077-26344099 GGTATGGTGAGGAGTCCAGATGG - Intergenic
1005637660 6:27766899-27766921 AGAATGGCATGAATTCCAGGTGG + Intergenic
1006597517 6:35204150-35204172 AGAATGGTGTGAACCCCAGGAGG - Intergenic
1007175165 6:39891459-39891481 GGCATGGTGGGGATTCAAGCAGG + Intronic
1010243765 6:73643247-73643269 GGAATGGTGTGAACCCCAAGGGG - Intronic
1015036296 6:128658896-128658918 GTTATTGTGTGGATTTCAGGGGG + Intergenic
1015605902 6:134954411-134954433 GGAAGGCTGTGTGTTCCAGGTGG + Intergenic
1017270095 6:152494386-152494408 GAAATGGAGTGAATGCCAGGTGG - Intronic
1018238134 6:161745721-161745743 GGCAAGGGGAGGATTCCAGGTGG + Intronic
1018378236 6:163233337-163233359 GGAATGGAGTAGAATGCAGGAGG + Intronic
1018689122 6:166329561-166329583 GGATTGCTGTGGCTTCCGGGCGG - Exonic
1019497805 7:1348482-1348504 GGAAGTGTGTCGATTCCAGACGG - Intergenic
1021954659 7:25812479-25812501 GGAAGGGTGTGGATGCTAAGTGG - Intergenic
1022447665 7:30483128-30483150 GAAATGGAGTGAATGCCAGGTGG - Intergenic
1023152416 7:37214515-37214537 GCTATGGTGTGGATTGCAGGTGG - Intronic
1027432980 7:78133543-78133565 GGAAAAGTGTGGAGTCCAGTGGG - Intronic
1028309419 7:89312069-89312091 GGAATGGTGTGGCTTGCCTGGGG + Intronic
1028346839 7:89793624-89793646 GAAATGATGTGGATGCCAAGGGG - Intergenic
1031108974 7:117582605-117582627 GCCATGGTATGCATTCCAGGAGG - Intronic
1031812832 7:126393284-126393306 GGAATGGTGTGGCCATCAGGAGG - Intergenic
1032225773 7:130030755-130030777 AGAATGGTGTGAACCCCAGGAGG - Intronic
1032851550 7:135799529-135799551 AGGATGGTCTGGATTCCAGAAGG - Intergenic
1035259785 7:157653964-157653986 GGCATGGTGTGGAGTCGGGGTGG - Intronic
1035259822 7:157654078-157654100 GGCATGGTGTGGAGTCGGGGTGG - Intronic
1036209492 8:6830936-6830958 GGAAGGCAGTGGATTCCATGAGG + Intronic
1038417959 8:27411378-27411400 GGTATGGTGTGAATTCAGGGGGG - Intronic
1038973901 8:32670346-32670368 GAAAAGTTGTGGATTCCATGTGG - Intronic
1041254929 8:55971928-55971950 GTTGTGCTGTGGATTCCAGGGGG + Intronic
1043338425 8:79206773-79206795 AGAATGGTGTGAACCCCAGGGGG - Intergenic
1045977899 8:108149942-108149964 GGAATGCTGTGGTTTTCTGGGGG - Intergenic
1047220812 8:122916876-122916898 GGAAGGGTGTGGATTTGGGGTGG - Intronic
1048571750 8:135662634-135662656 ACAAGGGTGTGGATGCCAGGAGG + Intergenic
1053481343 9:38418641-38418663 AGAATGATGTGGCTTGCAGGAGG + Intronic
1054909891 9:70444800-70444822 AGAAAGGTGTGAATGCCAGGAGG + Intergenic
1055289552 9:74768784-74768806 GTAATGGTGTGGATTTGAGGGGG - Intronic
1056043966 9:82696834-82696856 GGAATCTTGTGAATTCCATGGGG - Intergenic
1057184702 9:93050562-93050584 AGAATGAGGTGGTTTCCAGGAGG + Intergenic
1057778052 9:98026952-98026974 GAAATGGCGTGAACTCCAGGGGG - Intergenic
1059485254 9:114622045-114622067 GGAGAGGTGAGGATGCCAGGAGG + Intronic
1059602822 9:115799811-115799833 GGAAAGGAGTGGATACCAGGTGG + Intergenic
1061220466 9:129247568-129247590 GTCATGGTGGGGATTCCATGAGG + Intergenic
1061233894 9:129331188-129331210 GGAAATGTGTGAATGCCAGGAGG + Intergenic
1061521383 9:131120328-131120350 GGAAGGCTGGGGAGTCCAGGCGG - Exonic
1203387597 Un_KI270438v1:69478-69500 GGAGTGGAGTGGATTGCAGTGGG + Intergenic
1203387619 Un_KI270438v1:69628-69650 GGAGTGGAGTGGATTGCAGTGGG + Intergenic
1203350801 Un_KI270442v1:79865-79887 GGAATGGAGTGGAATTCAGTGGG + Intergenic
1185544076 X:927369-927391 CGAAGGGTGTGGACTCCAGAGGG - Intergenic
1187930410 X:24288531-24288553 CAAAGGGTGTGGATCCCAGGAGG + Intergenic
1188243783 X:27818444-27818466 GGCATAGTGTAGATTCAAGGAGG + Intronic
1189191519 X:39112329-39112351 GGAATGTTTTGGATGCCTGGGGG - Intergenic
1191805530 X:65131322-65131344 GAAATGGAGTGAATGCCAGGTGG + Intergenic
1195016813 X:100789062-100789084 GAAATGGAGTGAATGCCAGGTGG + Intergenic
1195802579 X:108730341-108730363 GGAATGGTGGGGATTGCCGGCGG - Intronic
1195869029 X:109466479-109466501 AGAATAGAGTGGATTCAAGGGGG + Intronic
1196541791 X:116918952-116918974 GGAAAGGAATGGATTCCTGGGGG + Intergenic
1196802892 X:119559413-119559435 GGAATGAAGAGCATTCCAGGTGG - Intronic
1198599151 X:138266120-138266142 GGAATGGGGTGAATGTCAGGTGG + Intergenic
1199110554 X:143928846-143928868 AGAATGGTGTGGAACCCGGGAGG + Intergenic
1200244952 X:154517998-154518020 GGGATGGTTTGGATTCCTGTGGG + Intergenic
1200750072 Y:6936803-6936825 GGTATGGAACGGATTCCAGGAGG + Intronic
1200927753 Y:8669804-8669826 GAATTGATTTGGATTCCAGGAGG - Intergenic
1201111457 Y:10802464-10802486 GGAATGGAGTGGATTGCAGTGGG - Intergenic
1201130522 Y:10948609-10948631 GGAATGGAGTGGAGTGCAGTGGG - Intergenic
1201136729 Y:10995702-10995724 GGAATGGAGTGGAGTGGAGGTGG - Intergenic