ID: 933892418

View in Genome Browser
Species Human (GRCh38)
Location 2:86783983-86784005
Sequence CTCCTGTGGAAGCAGGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 377}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933892418_933892430 16 Left 933892418 2:86783983-86784005 CCCAGGCCCTGCTTCCACAGGAG 0: 1
1: 0
2: 4
3: 37
4: 377
Right 933892430 2:86784022-86784044 CCTGCCTTGACTGGGTGTGCTGG 0: 1
1: 0
2: 1
3: 32
4: 327
933892418_933892431 17 Left 933892418 2:86783983-86784005 CCCAGGCCCTGCTTCCACAGGAG 0: 1
1: 0
2: 4
3: 37
4: 377
Right 933892431 2:86784023-86784045 CTGCCTTGACTGGGTGTGCTGGG 0: 1
1: 0
2: 1
3: 16
4: 212
933892418_933892427 8 Left 933892418 2:86783983-86784005 CCCAGGCCCTGCTTCCACAGGAG 0: 1
1: 0
2: 4
3: 37
4: 377
Right 933892427 2:86784014-86784036 ACCTGGCACCTGCCTTGACTGGG 0: 1
1: 0
2: 0
3: 10
4: 161
933892418_933892424 -9 Left 933892418 2:86783983-86784005 CCCAGGCCCTGCTTCCACAGGAG 0: 1
1: 0
2: 4
3: 37
4: 377
Right 933892424 2:86783997-86784019 CCACAGGAGGCCTCAAAACCTGG 0: 1
1: 0
2: 1
3: 23
4: 192
933892418_933892433 27 Left 933892418 2:86783983-86784005 CCCAGGCCCTGCTTCCACAGGAG 0: 1
1: 0
2: 4
3: 37
4: 377
Right 933892433 2:86784033-86784055 TGGGTGTGCTGGGCACCTCCTGG 0: 1
1: 0
2: 5
3: 42
4: 342
933892418_933892426 7 Left 933892418 2:86783983-86784005 CCCAGGCCCTGCTTCCACAGGAG 0: 1
1: 0
2: 4
3: 37
4: 377
Right 933892426 2:86784013-86784035 AACCTGGCACCTGCCTTGACTGG 0: 1
1: 0
2: 0
3: 7
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933892418 Original CRISPR CTCCTGTGGAAGCAGGGCCT GGG (reversed) Intergenic
900176430 1:1293408-1293430 CTCCTGGGCGAGCAGGGCCGCGG + Exonic
900275373 1:1822692-1822714 CCCCTGTGCAAGAAGGCCCTGGG + Intronic
900284578 1:1892942-1892964 CCCCTGTGGGGGCGGGGCCTCGG - Intergenic
900415858 1:2534424-2534446 CTCAGCTGGAGGCAGGGCCTGGG - Intergenic
900427508 1:2587245-2587267 CTCCTGCAGACCCAGGGCCTCGG - Exonic
900527554 1:3136538-3136560 CCCCTGTGGACCCAGGGACTTGG - Intronic
900586487 1:3434830-3434852 GTCCTCTGAAGGCAGGGCCTTGG + Exonic
900605380 1:3521422-3521444 CTCCTGCGGCAGCTCGGCCTGGG - Intronic
900784227 1:4637729-4637751 CTCGTGCGGAAATAGGGCCTCGG + Intergenic
900953962 1:5875499-5875521 CTCCTGTGGACGCTGGGCCCAGG - Intronic
901449142 1:9325494-9325516 CTCCCATAGAAGCAGGGCCTAGG - Intronic
902243991 1:15107287-15107309 CTGGAGTGGAAGCAGGCCCTGGG - Intronic
904314620 1:29652181-29652203 CTCCTGTGAGCGCAGGGCCAGGG + Intergenic
904413014 1:30336321-30336343 CCCATGAGGAGGCAGGGCCTGGG - Intergenic
905484597 1:38286353-38286375 GTGCTGTGGCTGCAGGGCCTTGG + Intergenic
905791064 1:40789871-40789893 CTCCTTTGTGGGCAGGGCCTCGG - Intronic
906963175 1:50431737-50431759 CACCTCTGGTCGCAGGGCCTGGG + Intergenic
907194459 1:52675282-52675304 CTCATGTGGAGGCTGAGCCTGGG + Intergenic
907481517 1:54748405-54748427 CTGCTGCCGCAGCAGGGCCTAGG - Intergenic
908953621 1:69593845-69593867 CATCTGTGGAAGCAGAGGCTGGG + Intronic
912389213 1:109290314-109290336 CTCCAGTGGAAGCAGGACCTAGG - Intergenic
912499895 1:110114769-110114791 CTGCTGAGGATGCAGGGCCCAGG - Intergenic
912588369 1:110787960-110787982 CTCTTGAGGAAACAGTGCCTTGG + Intergenic
913198142 1:116475008-116475030 CTGCTGTGGAGGCAGAGCCATGG + Intergenic
913280349 1:117179575-117179597 TGCATGTGCAAGCAGGGCCTGGG + Intronic
914754327 1:150554208-150554230 CACCTGAGGGAGAAGGGCCTTGG + Intronic
915118664 1:153615427-153615449 CTCCTGGAGAAGCAGGGTTTTGG - Intronic
918074659 1:181161077-181161099 GTCATTGGGAAGCAGGGCCTGGG + Intergenic
919568856 1:199221406-199221428 TTCCTGGGGAAACAGTGCCTTGG - Intergenic
919715986 1:200777083-200777105 CTCCTGAGGGAGTAGGTCCTGGG + Intronic
920434995 1:205941866-205941888 TTCACTTGGAAGCAGGGCCTGGG + Intronic
920499316 1:206476450-206476472 CTCCTGTGGAAGCAGGAGGTGGG - Intronic
920502036 1:206491519-206491541 CTGCTGTGGACGCAGGGCTTGGG + Exonic
922707220 1:227795827-227795849 CTCCTGAGGAAGGAGGGGGTTGG - Intergenic
922752334 1:228076166-228076188 CTCCTGTAGAACCAGGGTCTTGG - Exonic
924247664 1:242100567-242100589 CTGGTGAGGAAGCAAGGCCTTGG - Intronic
924576855 1:245288500-245288522 CTCGTGTGGAAGAAGGACATGGG + Intronic
1069268234 10:66490686-66490708 CTCATGTGGTAGCAGGGCCATGG + Intronic
1069613285 10:69789658-69789680 CTACTGTGAAAGCTGGGTCTGGG + Intergenic
1069905595 10:71730449-71730471 CACCTGTGGGAGCCGGGCCAGGG - Intronic
1072780447 10:98247611-98247633 CTCCCATGGAGCCAGGGCCTGGG - Intergenic
1073352974 10:102832808-102832830 ATCTTCTGGAAGCCGGGCCTGGG - Intronic
1073438231 10:103535424-103535446 CTCCTGGGGAATCAGTGCCCTGG - Intronic
1075426258 10:122343976-122343998 CCCGTGTGCAAGCAGGGCCTGGG - Intergenic
1076328220 10:129644896-129644918 GTCCTGTGGAGGCAGAGCTTGGG + Intronic
1076834682 10:133015040-133015062 CTCCGGTGGAAGGAAGTCCTGGG + Intergenic
1076851542 10:133095797-133095819 CTCCTGTGCAGGAAGGGCCATGG - Intronic
1076855868 10:133115401-133115423 CACCTGTGAAAGCCGGGCCCTGG + Intronic
1077029611 11:459021-459043 CTCCAGTGGATGTAGGACCTGGG + Intronic
1077029676 11:459341-459363 CTCCGGTGGATGTAGGACCTGGG + Intronic
1077060939 11:617620-617642 CGCCTGGGGAGGCAGGGCCGGGG + Exonic
1077182828 11:1224158-1224180 CACCTGAGCAGGCAGGGCCTAGG + Intronic
1077308492 11:1878291-1878313 CACCTGAGGAGGCAGAGCCTGGG - Intronic
1077865473 11:6218051-6218073 TTCCTGCGGCAGCAGAGCCTGGG - Exonic
1078156806 11:8806816-8806838 CTCCTGGGGAGGCAGGGGCTGGG - Intronic
1078396066 11:10983204-10983226 CTCCTGGGAAATCACGGCCTCGG - Intergenic
1079034547 11:17011028-17011050 CTCCTGTGCCCCCAGGGCCTTGG - Intronic
1079139873 11:17801223-17801245 TTCAAGGGGAAGCAGGGCCTTGG + Intronic
1079390988 11:20022016-20022038 CTCCAGTGGAAGCAGGGAGCGGG - Intronic
1079928571 11:26527904-26527926 CAGCTGTGAAAGCAGGGCATGGG - Intronic
1081600302 11:44488205-44488227 CTCCAGTGGAGGCCGGGCCCTGG - Intergenic
1081610572 11:44560654-44560676 CTGCTCTTGAACCAGGGCCTTGG + Intergenic
1082784916 11:57311484-57311506 CTCCGGAGGGAGCAGGGCCAGGG - Intronic
1083418727 11:62541824-62541846 TTCCTTTGGAACAAGGGCCTTGG - Intronic
1083730693 11:64650916-64650938 GTCCTCTGGAGGCAGGGACTGGG + Intronic
1083818354 11:65150841-65150863 CTCCTATTGAAGCAGTGTCTCGG + Intergenic
1084728076 11:70954904-70954926 CTCCTGTGGATGAAGAGCCCAGG - Intronic
1086136270 11:83446371-83446393 CTCCTGGGGGAGGTGGGCCTGGG + Intergenic
1088712024 11:112517018-112517040 CTCCTGTAGAAGCAGGACACAGG + Intergenic
1089480043 11:118797185-118797207 CTCCTGTGCAACCAGGGCTCAGG + Intergenic
1089629221 11:119773605-119773627 CTACTCTGGAAGCAGGGGCATGG + Intergenic
1090470747 11:126978773-126978795 CTCCTGTGGGAGCAGACACTAGG - Intronic
1091084150 11:132704125-132704147 CTCCTGTGGACTCAGGCTCTAGG - Intronic
1091271197 11:134313049-134313071 CTCCTGAGGGGCCAGGGCCTGGG - Intronic
1091406951 12:214964-214986 GTCCTCTGGAAGCAGAGGCTGGG + Intergenic
1091653158 12:2324536-2324558 CTCCTGGGGAGGCGGGGCCCGGG - Intronic
1092122841 12:6056749-6056771 TTCCTGTGGAAAGAGGGCGTAGG - Intronic
1092158052 12:6297363-6297385 CTGCTATGGAAGCAGGAGCTTGG + Intergenic
1092241978 12:6840915-6840937 CTCCTCTGGCAGCAGAGCCTGGG + Exonic
1093678624 12:21974121-21974143 CTTCTGTGTAAGCAGTGCATGGG + Intergenic
1096973952 12:55687960-55687982 CTCCTGTGGAAGGTGAGGCTTGG - Exonic
1102533973 12:113567338-113567360 CATCTGTGGAATGAGGGCCTGGG + Intergenic
1102875285 12:116444180-116444202 GTCCTGTCGAAGGAGGGCCCAGG + Intergenic
1103717288 12:122952320-122952342 CTTCAGTGGAAACAGGTCCTGGG - Intronic
1104299571 12:127552014-127552036 CTCCTGTGAATGCAGGGTCACGG + Intergenic
1104886759 12:132114810-132114832 CTCATGTAGTGGCAGGGCCTGGG + Intronic
1104982010 12:132577365-132577387 CTCCTGGGAAAGCGGGGGCTGGG - Intronic
1105016400 12:132788536-132788558 TTCCTGTGGAAGCTGAGCCTGGG - Intronic
1105591489 13:21796773-21796795 CTCCTCTGGAAGCAGGTGCTCGG + Intergenic
1107080007 13:36364804-36364826 CCCCTGTGGCAGGAGGACCTTGG - Intronic
1107673411 13:42770150-42770172 CACCTGTGGCAGAAGGGGCTAGG - Intergenic
1111766954 13:92543650-92543672 CTCCTGTAAAATCAGTGCCTTGG - Intronic
1113349370 13:109513527-109513549 CTCCTGTGGGCTCAGGGCCTGGG + Intergenic
1113349381 13:109513577-109513599 CACCTGTGGGCTCAGGGCCTGGG + Intergenic
1113349392 13:109513627-109513649 CTCCTGTGGGCTCAGGGCCTGGG + Intergenic
1113349403 13:109513677-109513699 CTCCTGTGGGCTCAGGGCCTGGG + Intergenic
1113349414 13:109513727-109513749 CTCCTGTGGGCTCAGGGCCTGGG + Intergenic
1113784837 13:112996989-112997011 CAGCTGTGGGAGCTGGGCCTAGG + Intronic
1116948092 14:50854820-50854842 CTTGTGTGGAAGCAGCTCCTAGG + Intergenic
1119022433 14:71126570-71126592 CTCCTGGGGAAGGAGGTTCTGGG - Intergenic
1119861186 14:77937357-77937379 CAGCTGTGGCAGCAGGGCCCTGG - Intergenic
1120867685 14:89309674-89309696 CTGCTGTAGAGGCCGGGCCTTGG - Intronic
1120940414 14:89942915-89942937 GCCCTTGGGAAGCAGGGCCTGGG + Intronic
1121329336 14:93040302-93040324 CTCCTATGAAAGCAGGGCCTCGG + Intronic
1121864841 14:97353202-97353224 CTCCGGTGGAAGGAGGGACTTGG - Intergenic
1122183016 14:99969577-99969599 CTCAGGTGGAAGCAGGGCACAGG + Intergenic
1122541224 14:102498631-102498653 CTAATGTGGAAGGAGGCCCTGGG - Exonic
1122883414 14:104700084-104700106 CTCCTGGGGAGGCAGGCGCTTGG + Intronic
1122937786 14:104967897-104967919 CTCCTGAGGAAGCCCCGCCTCGG + Intronic
1123153434 14:106203743-106203765 CTCAGGTGGAAGGAGGGCTTTGG - Intergenic
1123469006 15:20536339-20536361 CACCTGTGGCAGCAGGAGCTTGG + Exonic
1123649052 15:22464352-22464374 CACCTGTGGCAGCAGGAGCTTGG - Exonic
1123729282 15:23131327-23131349 CACCTGTGGCAGCAGGAGCTTGG + Exonic
1123747450 15:23328809-23328831 CACCTGTGGCAGCAGGAGCTTGG + Intergenic
1123762245 15:23441976-23441998 CACCTGTGGCAGCAGGAACTTGG + Exonic
1124279811 15:28352661-28352683 CACCTGTGGCAGCAGGAGCTTGG + Intergenic
1124302887 15:28558943-28558965 CACCTGTGGCAGCAGGAGCTTGG - Intergenic
1124531983 15:30516593-30516615 CGCCTGTGGCAGCAGGAGCTGGG - Intergenic
1124620787 15:31272755-31272777 CACCTGTGGGGGCAGGGCCACGG - Intergenic
1124646216 15:31439322-31439344 CTCCTGTGAAAGCAGGGTGTAGG + Intergenic
1124766670 15:32491052-32491074 CGCCTGTGGCAGCAGGAGCTGGG + Intergenic
1125207998 15:37176752-37176774 CTTCTGTGGTAGAAGGGCCAAGG - Intergenic
1125361982 15:38873947-38873969 CTCCTGCACAAGAAGGGCCTAGG + Intergenic
1125481225 15:40082312-40082334 CTCCTGAGGAAGCAGAACCAGGG - Intergenic
1125983974 15:44031230-44031252 CCCCTGTGGAAGAGGGGCCCTGG - Intronic
1126290461 15:47070772-47070794 CACCTGTTGAAGGAGGGACTTGG + Intergenic
1127408640 15:58681753-58681775 ATTCTGAGGAAGAAGGGCCTTGG + Intronic
1128114340 15:65095946-65095968 CAACTGTGGAAGGAGGGCATGGG - Intronic
1128604730 15:69028164-69028186 CAACTGTGGCCGCAGGGCCTGGG - Intronic
1129848513 15:78778979-78779001 CTCCTCTGAAATCAGGGCTTCGG - Intronic
1129891635 15:79075505-79075527 CCCCTCTGGAAGCTGGGGCTGGG + Intronic
1129943901 15:79522733-79522755 CTCCTGTAGAACCAGTGCTTTGG - Intergenic
1130889538 15:88121726-88121748 CTCCTGCTGGAGCAGGGCCCTGG - Intronic
1130944740 15:88542307-88542329 CTCAGGTGGAAGGAGAGCCTTGG + Intronic
1132031375 15:98440928-98440950 TTCTCGTGGCAGCAGGGCCTTGG - Intronic
1132538587 16:496426-496448 CTCCTGTCACAGCGGGGCCTGGG + Intronic
1132858376 16:2057738-2057760 CTCCTATGGAACCAGGCCCTGGG + Intronic
1132858502 16:2058148-2058170 CTCCCGTAGAACCAGGCCCTGGG + Intronic
1132959467 16:2613878-2613900 CTCCTGAGGTGGCCGGGCCTTGG + Intergenic
1132972528 16:2695853-2695875 CTCCTGAGGTGGCCGGGCCTTGG + Intronic
1132973411 16:2700057-2700079 CTCCAGTGGAAACAGGGCACAGG - Intronic
1135158749 16:20075035-20075057 CTCCTGGGGATGCCTGGCCTGGG - Intergenic
1135511798 16:23091474-23091496 ATCCTTTGGAAGCACAGCCTAGG + Intronic
1135734227 16:24918026-24918048 CTCCAGAGGAAGCAGGGACTTGG - Intergenic
1136333089 16:29594775-29594797 CTCCGGTGGGTGGAGGGCCTAGG + Intergenic
1136447785 16:30334863-30334885 CTCCGGTGGGTGGAGGGCCTAGG + Intergenic
1136613415 16:31380780-31380802 CACCTCTTGGAGCAGGGCCTGGG + Intronic
1136656394 16:31711745-31711767 CTGCTGTGGAAGCCTGGACTGGG + Intergenic
1136750144 16:32628289-32628311 CTCCTGTGGAAGCTGCTCCTTGG + Intergenic
1138757849 16:59510305-59510327 CTGCTATGGGAGCAGTGCCTTGG - Intergenic
1140754757 16:78057049-78057071 CACTAGTGGAAGCAAGGCCTGGG - Intronic
1141170617 16:81688411-81688433 CTTCTGTGACAGCAGAGCCTTGG - Intronic
1141184198 16:81775428-81775450 CTCCTGTGAAAGCATGAACTTGG - Intronic
1141464490 16:84196909-84196931 CTCCTGGACCAGCAGGGCCTGGG + Exonic
1141694723 16:85613992-85614014 TTCCTCGGGAAGCAGGGCGTGGG - Intronic
1141788068 16:86214883-86214905 CTCCAGTGGGGTCAGGGCCTGGG - Intergenic
1141802910 16:86323255-86323277 CTCCTGTGAATCCAGGGGCTGGG + Intergenic
1142288310 16:89180517-89180539 CTCCTCCGGCTGCAGGGCCTCGG - Intronic
1203052274 16_KI270728v1_random:887488-887510 CTCCTGTGGAAGCTGCTCCTTGG + Intergenic
1142478680 17:204810-204832 CACGTCTGGAAGCAGAGCCTGGG + Intergenic
1142493254 17:292325-292347 GTCATTTGGCAGCAGGGCCTGGG - Intronic
1143188450 17:5024210-5024232 CTTCTGGGGAAGCAGCGTCTCGG - Exonic
1143375980 17:6468012-6468034 CTCCTGTGGAACCAGGCCATGGG + Intronic
1143584967 17:7846443-7846465 CTCCAGTGGGGGCAGGACCTTGG - Exonic
1144209687 17:13003701-13003723 CTGCTGTGAGAGCATGGCCTGGG - Intronic
1144445388 17:15322623-15322645 AACCTGTGGGAGCAGGGTCTGGG - Intronic
1144750162 17:17642885-17642907 CTCCTCCAGAAGCAGAGCCTGGG + Intergenic
1144773208 17:17770939-17770961 CTCCTAAGGACCCAGGGCCTGGG + Intronic
1145090016 17:19978269-19978291 CTCCTGAGGAAGCAGGGACTGGG - Intronic
1145266820 17:21383562-21383584 GTCTTGTGGAAATAGGGCCTGGG + Intronic
1145389251 17:22443138-22443160 CTCCTGCTGATGCCGGGCCTTGG - Intergenic
1145877534 17:28330979-28331001 CTCCTGGGGAAGCAGGGTTGGGG - Intronic
1146519432 17:33514903-33514925 ATCCCCTGGAAGCAGGACCTCGG + Intronic
1146569228 17:33938681-33938703 CTACTGTGTATGCAGTGCCTGGG + Intronic
1147811299 17:43171550-43171572 CCCCAGTGGAATGAGGGCCTAGG + Intronic
1148022481 17:44562585-44562607 CACCTGTGGCACCTGGGCCTGGG + Intergenic
1148657652 17:49299862-49299884 TTTCTGTAGAGGCAGGGCCTCGG + Intronic
1148778761 17:50110173-50110195 CTCCTGGGGGAGCAGGGGGTGGG + Exonic
1148849453 17:50547736-50547758 CTCCTGTGGGGCCAGGTCCTGGG - Exonic
1149237818 17:54613151-54613173 CTCCTGTGGACCCAGGCACTAGG + Intergenic
1150057447 17:62031504-62031526 CTCTTGTGGAAGCAGGCACTTGG + Exonic
1151236069 17:72720508-72720530 CTCCTGGGGAGGCAGGGAGTGGG + Intronic
1151972613 17:77466571-77466593 CTCCCGAGGACCCAGGGCCTGGG - Intronic
1152147448 17:78576929-78576951 CCCCTCCGGAAGCATGGCCTGGG - Intronic
1152710773 17:81869659-81869681 CACCAGTGGAAGTAGGGGCTGGG + Intronic
1153994981 18:10432878-10432900 CTGCTGTGCAAACAGGGGCTGGG - Intergenic
1154289606 18:13095800-13095822 CAACAGTGGAAGCAGGGCCTGGG - Intronic
1158782994 18:60674500-60674522 CTCCTGTGCATGCAGGTCCACGG - Intergenic
1159080127 18:63727094-63727116 TTCCTGAGGAAGCAGGCACTGGG - Intergenic
1160517488 18:79486608-79486630 CTGCTGTGGCAGCAGGGCCGGGG - Exonic
1161353056 19:3804361-3804383 CCCTTGTGGTAGCAGGGCCCGGG - Exonic
1162536780 19:11267277-11267299 CCCCTGTGGAAGCTGGGTCAAGG + Intergenic
1162563951 19:11434963-11434985 GTCCTGAGGAGGCAGGGCGTTGG + Exonic
1162792459 19:13070124-13070146 CTCCTGGGGAGGCAGCTCCTGGG - Intronic
1162898272 19:13778407-13778429 AACCTGTGGAGGCAGGACCTGGG - Exonic
1163596185 19:18222280-18222302 CTCGTGTGGGAGGAGGGCCCTGG - Exonic
1164207225 19:23069077-23069099 GTCCTCTGTAGGCAGGGCCTAGG + Intergenic
1165081607 19:33310155-33310177 CTCCTACAGAAGCAGGGCCAGGG - Intergenic
1165393281 19:35550397-35550419 CTCCTGGAGCAGCAGCGCCTGGG - Exonic
1165784221 19:38451759-38451781 CTCCTGGTGCAGCATGGCCTAGG - Exonic
1166869497 19:45862991-45863013 CTCCTAAAGAAGCAGGGGCTCGG - Intronic
1167438237 19:49492330-49492352 CTGCTGTGGAGGCAGGCCCCTGG + Intergenic
1167645277 19:50702440-50702462 CCAGGGTGGAAGCAGGGCCTGGG - Intronic
1167784645 19:51627326-51627348 CTCCTGTCTGAGCAGGGCCCTGG - Intronic
1168186839 19:54705539-54705561 CTCCTGTGGAGGGAGGGGCCTGG + Intergenic
925087335 2:1118170-1118192 CAGCTGTGGAACCAGGGCCCTGG - Intronic
926268355 2:11345215-11345237 GTCCTGGGGCAGGAGGGCCTGGG + Intronic
927028928 2:19100401-19100423 CTGCTGTGGAAGCTGGGCACTGG - Intergenic
927893315 2:26765759-26765781 CTCAGGAGGATGCAGGGCCTGGG - Intronic
928167427 2:28981358-28981380 CTCCTGTCTGAGCAGGGGCTGGG - Exonic
929133561 2:38602376-38602398 CTCCCCGGGAAGCAGGGCCTCGG - Intronic
929966810 2:46542751-46542773 CTCCTGGGGAGGCCGGGCCGGGG + Exonic
930027994 2:47041142-47041164 TCCCTGTGAAAGCAGGACCTGGG - Intronic
930930608 2:56877142-56877164 CTACTGTGGAACCAGGACATTGG + Intergenic
931455949 2:62409929-62409951 CTCTTGAGGAAGCAAGGCCATGG + Intergenic
932323321 2:70837854-70837876 CTCGTGTGGTTGCAGAGCCTTGG + Intergenic
932453773 2:71833028-71833050 GCCCTTGGGAAGCAGGGCCTTGG + Intergenic
932620927 2:73264622-73264644 ATGCTGTGGTACCAGGGCCTAGG + Intronic
933892418 2:86783983-86784005 CTCCTGTGGAAGCAGGGCCTGGG - Intergenic
933902597 2:86860774-86860796 CTCCTGTAAGAGCAAGGCCTGGG + Intronic
935124678 2:100213031-100213053 CAGCTGTGGAAGATGGGCCTTGG - Intergenic
935777950 2:106488494-106488516 CTCCTGTAAGAGCAAGGCCTGGG - Intergenic
936458253 2:112692108-112692130 CTTCTCTGGAAGCAGGCGCTGGG - Intergenic
936717230 2:115201742-115201764 CCACTGTGGAAGGAGGGGCTGGG - Intronic
936876239 2:117193051-117193073 ACCCTGTGGCAGCAGGGACTAGG - Intergenic
937451972 2:122009602-122009624 TTCCCATGGATGCAGGGCCTGGG + Intergenic
937738347 2:125318854-125318876 CTCCTGTGGACCCAGGCTCTAGG - Intergenic
938108804 2:128550924-128550946 CTCCTGCGGAACCCGGGCCTGGG + Intergenic
940856077 2:158729661-158729683 CTCCTGTGGTAGAGGGGCCTGGG + Intergenic
940986765 2:160058793-160058815 CTTCTGTGAAACCAGTGCCTGGG - Intronic
942172272 2:173299901-173299923 TTCCTTTGGAAGGAGGTCCTGGG - Intergenic
944395639 2:199263229-199263251 CTCCTGAGGAAACAGGACCAGGG - Intergenic
946162093 2:217841550-217841572 CTCTTGGAGAAGCAGGACCTTGG - Intronic
946709733 2:222493438-222493460 CACATGTGGAAGGAGGGCCCAGG - Intronic
1168875190 20:1166555-1166577 CTCAGATGGAAGCTGGGCCTGGG + Exonic
1170793359 20:19525849-19525871 CGCCTGTGGAATGAGGGGCTGGG - Intronic
1171134375 20:22683826-22683848 CTCCTCTGGGTGAAGGGCCTGGG + Intergenic
1172191414 20:33064025-33064047 CTGCTGTGGCTGCGGGGCCTTGG - Intronic
1172774335 20:37398370-37398392 ATCCGGTGGAAGAGGGGCCTGGG - Intronic
1172804069 20:37598552-37598574 CTCCTGGGGAGGGAGGGGCTCGG + Intergenic
1173155156 20:40602366-40602388 CTCCTGTTCAAGAGGGGCCTGGG - Intergenic
1173297502 20:41772508-41772530 GTCCTCTGGAAGCAGAACCTGGG - Intergenic
1173347979 20:42218465-42218487 TTCAGGTGGAAGAAGGGCCTAGG - Intronic
1173551681 20:43937201-43937223 GTCCTGTGGAAGGAGGGGCCTGG + Intronic
1174484301 20:50851660-50851682 CCCCTGTGGCAGCAGTGCCCTGG + Intronic
1175390140 20:58621928-58621950 CTTCTTTAGTAGCAGGGCCTGGG - Intergenic
1175757671 20:61539740-61539762 GTCCTGTGACAGCAGGGCTTGGG - Intronic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1176303446 21:5111010-5111032 CTGCTGCTGAATCAGGGCCTGGG + Intergenic
1177171683 21:17662338-17662360 CCCCCCTGGAAGAAGGGCCTTGG + Intergenic
1179261106 21:39758645-39758667 CTCCTGTGTGTGCAAGGCCTGGG + Intronic
1179433829 21:41345612-41345634 CACTTGTGGCACCAGGGCCTGGG - Intronic
1179730925 21:43367000-43367022 CTCCTGGGGATTCAGGGCCCTGG + Intergenic
1179823980 21:43953599-43953621 ATCCTGTGGAAGAAGGGCAGTGG + Intronic
1179853586 21:44150940-44150962 CTGCTGCTGAATCAGGGCCTGGG - Intergenic
1180109277 21:45640490-45640512 AGCCTGGGGAAGCAGGGGCTGGG + Intergenic
1180605926 22:17058577-17058599 CTCCTTTGGAAGCACTGACTTGG - Intergenic
1182118723 22:27773332-27773354 CTCCTGGGGAAGCAGATGCTGGG + Intronic
1182285019 22:29241192-29241214 CTCCAGAGGAACCAGGGCCAGGG - Intronic
1182821718 22:33222340-33222362 CTGCTGAGAAAGAAGGGCCTTGG + Intronic
1184603054 22:45554767-45554789 TGCCTGAGGAAGCAGGGCCCAGG - Intronic
1184647552 22:45904269-45904291 CTCCTGTGGGTGGAGGGCGTGGG + Intergenic
1184841953 22:47057277-47057299 CTCCCGTGGAAGGAGGAGCTTGG - Intronic
1185104559 22:48859973-48859995 ATCCTGTGCAAGGAGGGCCTGGG + Intergenic
949162094 3:894133-894155 CTCCTGTGGGAGGAGGTTCTGGG + Intergenic
949190397 3:1243276-1243298 CTCCTGGGGAAGGAGGTTCTGGG + Intronic
949219630 3:1616267-1616289 CTCCTGAAGAAGAGGGGCCTAGG + Intergenic
950297895 3:11847752-11847774 GCCCTGTGGCAGGAGGGCCTTGG + Intergenic
953828697 3:46276973-46276995 CTCCTTTGGATGGAGGGCTTTGG + Intergenic
954306026 3:49725886-49725908 CACCTGTGGAGGAAGGGCATGGG + Exonic
954391768 3:50271300-50271322 CTCTTGGGGCAGGAGGGCCTGGG - Intronic
954422292 3:50425074-50425096 GCCCTGTGGAAGCATGGCCCTGG - Intronic
954810375 3:53243737-53243759 CTCCAGTTGAAGCTGGCCCTGGG - Intronic
955622275 3:60877433-60877455 CTCCTGGGGAAACAGTGCTTTGG + Intronic
956793663 3:72699784-72699806 TTCCTCTGGAAGCAGCCCCTGGG + Intergenic
957948800 3:87097822-87097844 CACCTCTGGGAGCAGGGCATAGG - Intergenic
958626631 3:96633278-96633300 CTCCTGTGGTAGAAGGGGCAAGG - Intergenic
960169053 3:114437141-114437163 CTCCTCTGCCAGCAGAGCCTAGG - Intronic
960935704 3:122900145-122900167 TTCCTGGGGAACCAGGGCCATGG + Intergenic
962927344 3:140007324-140007346 ATGGTGTGGAAACAGGGCCTGGG + Intronic
962928393 3:140015714-140015736 AGACTGTGGAAGCTGGGCCTAGG + Intronic
963603414 3:147395796-147395818 CCTCTGGGGAAGCAGGCCCTCGG - Intronic
965444899 3:168763408-168763430 TTCCCATGGAAGCAGGCCCTGGG - Intergenic
965521454 3:169671457-169671479 AGCCTGTGGCAGCAGGACCTGGG + Intergenic
966509718 3:180748309-180748331 CTCCTTTGGAAGCAGGTAGTTGG - Intronic
966866340 3:184260881-184260903 CACCTCTGGAAGCAGAGCCCTGG - Intronic
968500268 4:946727-946749 CGCCTGTGGGAGCCGGGGCTGGG - Intronic
968534329 4:1113755-1113777 GTTTTGTGGAAGCCGGGCCTGGG + Intergenic
968977384 4:3829087-3829109 AGCTTGTGGAAGCAGGGCCCTGG - Intergenic
969490869 4:7498596-7498618 CTCCTAGGGACGCAGGGCCTGGG + Intronic
969605111 4:8198540-8198562 CTGCTGAGGAAGCCTGGCCTGGG - Intronic
969691040 4:8704331-8704353 CTCCTGTGGATGTACTGCCTCGG + Intergenic
971691817 4:29846445-29846467 TTCTTGTGGAAGCAGGCCCAGGG + Intergenic
976572280 4:86626203-86626225 GTCCTTTGAAAGCAGGGACTAGG + Intronic
978015321 4:103737608-103737630 CTCCTGTGCAAATGGGGCCTAGG - Intergenic
978245513 4:106567623-106567645 GTCCTATGGAAGCAGGACCAGGG - Intergenic
980522476 4:133951489-133951511 CTCCTCTACCAGCAGGGCCTTGG + Intergenic
981226957 4:142308074-142308096 CTCCTGTGGAAGCAGAACGTTGG + Intronic
981286075 4:143020444-143020466 CTCCTGAGAAAACAGTGCCTTGG - Intergenic
982350399 4:154409013-154409035 CTCCTGTGGAATCAGTGCCTTGG + Intronic
984759079 4:183348412-183348434 CTCCTGCGGGTGCAGGGCCCTGG - Intergenic
985260689 4:188112191-188112213 CTCCATTAGAAGCAGGGGCTTGG + Intergenic
985659737 5:1151078-1151100 CTGCTGTGCCAGCAGGGTCTGGG + Intergenic
986313863 5:6573211-6573233 CACCTGTGGCAGCAGTGCCCAGG - Intergenic
987152456 5:15056572-15056594 CTCCTGGGGAAACATTGCCTTGG - Intergenic
989492704 5:42076644-42076666 ATCCTGTGCCACCAGGGCCTTGG + Intergenic
996330029 5:122318117-122318139 CTCCTGTGGGTGCAGGGGATGGG + Intronic
996806177 5:127456796-127456818 CACCTGTGGAATAAGGGGCTTGG + Intronic
998725271 5:145005465-145005487 CTCCTGTGCCAGCAGGCTCTTGG + Intergenic
1001113225 5:168916334-168916356 CTCCTCTGGAGGGAAGGCCTGGG + Intronic
1002224959 5:177713847-177713869 CTCCTGCGGAAGCTGCTCCTCGG - Intronic
1002260509 5:177990869-177990891 CTCCTGCAGAAGCAGGGCAAGGG - Intergenic
1002339213 5:178503936-178503958 CTCCTTGGGAAACAGGTCCTCGG + Intronic
1002401526 5:178994004-178994026 CTGCTCTGGAAGAAGGGCCCGGG + Intronic
1003078024 6:2999705-2999727 CCGCTGTGGAGGCGGGGCCTGGG + Intronic
1003500654 6:6700268-6700290 CTCCTCTGAAAGCTGGGCCAAGG + Intergenic
1004348179 6:14867632-14867654 TGCTTATGGAAGCAGGGCCTGGG + Intergenic
1004409527 6:15367789-15367811 CTCCTGGGGAAGCAGGAGTTGGG - Intronic
1006431528 6:34000288-34000310 CTCCTGTTGAGGCAGAGCCTGGG + Intergenic
1006718620 6:36135969-36135991 CTGGTGTGGAAGCTGGGCCATGG + Intronic
1007217717 6:40253457-40253479 TTCCTGTGAAAGCTTGGCCTGGG + Intergenic
1010792032 6:80075711-80075733 CTCCTGGGAAAGCAGTACCTTGG - Intergenic
1013430043 6:110047607-110047629 CTCTTCTGGTAGCAAGGCCTTGG + Intergenic
1017282241 6:152637189-152637211 CTCCTGGAGATGCACGGCCTTGG + Exonic
1017875025 6:158517127-158517149 CACCTGTGGAACAAGGGTCTTGG - Intergenic
1018170450 6:161139679-161139701 TTCCCTTGGAAGCAGGGCCTCGG - Intronic
1019441141 7:1047711-1047733 ATCCTGAGGATGCAGTGCCTGGG + Intronic
1022443976 7:30455085-30455107 CACCAGTGCAAGCAGGGCCCTGG - Intronic
1023339735 7:39207339-39207361 TTCCTGTGGAACCAAGGCATGGG - Intronic
1023983332 7:45081933-45081955 CTGATGTGGCAGCAGGGCCAGGG - Intronic
1024229399 7:47352795-47352817 CACCTGTGGACCCAGGGGCTGGG - Intronic
1024539430 7:50464030-50464052 CTGCTATGGAAGCAGGGCCCAGG - Intronic
1026210949 7:68304626-68304648 CTCCTGTGGTAGGAGGGCCAGGG + Intergenic
1026804558 7:73421896-73421918 GATCTGTGGAACCAGGGCCTGGG - Intergenic
1026881474 7:73909208-73909230 CTCTGGTGGCAGCAGGGTCTTGG + Intergenic
1027050559 7:75018898-75018920 CTCTGGTGGGTGCAGGGCCTGGG - Intronic
1029372381 7:100158100-100158122 CCCCTGAGGTAGCAGGGCCCGGG + Exonic
1033511845 7:142067193-142067215 CTCCTGATGAAGCTAGGCCTAGG + Intronic
1033514916 7:142096183-142096205 CTCCTGATGAAGCTAGGCCTAGG + Intronic
1033545965 7:142400448-142400470 CTCCTGTGAAGGCTGGGACTTGG - Intergenic
1034330046 7:150274640-150274662 CACCTGAGGACGCAGGGGCTGGG + Intronic
1034668009 7:152835221-152835243 CACCTGAGGACGCAGGGGCTGGG - Intronic
1034928944 7:155145072-155145094 CACGTGTGGAAGGAGGGACTTGG - Intergenic
1035016998 7:155775185-155775207 CTCCTCTGGAATCAGGCCCGTGG - Exonic
1035182103 7:157097051-157097073 CTCAGGTGGAAGCAGGGGCAGGG + Intergenic
1035184286 7:157113727-157113749 CACCTGTGGCAGGAGGGACTTGG + Intergenic
1035324736 7:158057659-158057681 CTCATGAGGAAGTGGGGCCTGGG - Intronic
1035893879 8:3375351-3375373 CACCTGTGAAAGCACAGCCTTGG + Intronic
1036084363 8:5597764-5597786 CATCTGTGCAAGCAGGGCATGGG + Intergenic
1036852095 8:12209865-12209887 CTCCTGTGTCAGCCGGTCCTTGG - Intergenic
1036873462 8:12452387-12452409 CTCCTGTGTCAGCCGGTCCTTGG - Intergenic
1037673709 8:21036981-21037003 CTCCTGTCAAAGCAGGGCCCAGG - Intergenic
1039130180 8:34255008-34255030 CTCCTGGGGAGGTAGGGTCTGGG - Intergenic
1039131989 8:34275593-34275615 CTCCTTGGGAACCAGGGCCAGGG + Intergenic
1040375183 8:46817911-46817933 CCCCAGTGGAAGCAGGGTCCAGG - Intergenic
1040378161 8:46846426-46846448 CCCCAGTGGAAGCAGGGTCCAGG - Intergenic
1041477551 8:58282849-58282871 AGCCTCGGGAAGCAGGGCCTTGG + Intergenic
1042243768 8:66690590-66690612 CTCCTGTGGAACTGGGGACTTGG + Intronic
1044339871 8:91034572-91034594 ATACTGAGCAAGCAGGGCCTTGG - Intronic
1048865831 8:138760867-138760889 CTCCTGCAGGAGCAGGGCGTGGG + Intronic
1048981473 8:139705133-139705155 CTCATCTGGAAGCAGGGAATAGG - Intergenic
1049023764 8:139974797-139974819 CTCATGTGGAGGCTGGGCCCAGG + Intronic
1049447439 8:142637856-142637878 CACAGGCGGAAGCAGGGCCTGGG + Intergenic
1049479669 8:142815879-142815901 CTCCTTTGGGAGCAGAGACTGGG + Intergenic
1050494605 9:6227864-6227886 CTGCTCTGGATGCAGGGGCTAGG + Intronic
1051690779 9:19710068-19710090 CTCCTGTGGAAGGATGTCTTTGG + Intronic
1052277357 9:26692226-26692248 TTCCTGGGGAAGAAAGGCCTAGG + Intergenic
1052456081 9:28699994-28700016 CTTCTGAGGAAACAGGGCCAGGG - Intergenic
1053058027 9:35005730-35005752 CTCCTGGGGGAGGCGGGCCTGGG - Intergenic
1055514922 9:77024205-77024227 CTCCCTTGGGATCAGGGCCTTGG - Intergenic
1056013011 9:82352510-82352532 GTCTTGTGGAAGCAGGGCAATGG + Intergenic
1056505848 9:87257617-87257639 CTCCTCTGGAAGCAGAACTTGGG + Intergenic
1057817115 9:98304034-98304056 CTCCGGTCGAAGCAGGCTCTGGG + Intronic
1057915489 9:99052227-99052249 CTCCTGGGGACTCAGGGCTTTGG + Intronic
1057941323 9:99287808-99287830 TTCCAGTGCCAGCAGGGCCTAGG + Intergenic
1059442399 9:114316008-114316030 CTCATGTGGAAGCAGGTCACAGG + Intergenic
1059769844 9:117414859-117414881 CCCGGGTGGAAGCAGAGCCTCGG + Exonic
1060395784 9:123315451-123315473 CTCCGGTGGCAACAGGTCCTGGG - Intergenic
1060407377 9:123379557-123379579 CTCCTGTAGAGGCAGGGGCCAGG - Intronic
1060665864 9:125431826-125431848 TTGCTGTGGGAGCAGGACCTGGG + Intergenic
1061515928 9:131090465-131090487 CTCCTAGGTCAGCAGGGCCTTGG + Intronic
1062056765 9:134472888-134472910 CTCCTGTGTATGCATGGCCCTGG + Intergenic
1062266042 9:135687043-135687065 CTCCTGGAGTAGCAGGGTCTCGG - Intergenic
1185625702 X:1480508-1480530 CTCCTGTGTAAGCTGGGACATGG + Intronic
1187446974 X:19369013-19369035 CTCCTCTGGGAGCAGGCGCTGGG - Intronic
1187476295 X:19614084-19614106 CACCTGAGGCAGCAGGGACTAGG - Intronic
1190341798 X:49303026-49303048 CTGCTGTGGGAGCATGTCCTTGG + Intergenic
1190344007 X:49321414-49321436 CTGCTGTGGGAGCATGTCCTTGG + Intergenic
1190345101 X:49330959-49330981 CTGCTGTGGGAGCATGTCCTTGG + Intergenic
1190346195 X:49340525-49340547 CTGCTGTGGGAGCATGTCCTTGG + Intergenic
1190347447 X:49531554-49531576 CTGCTGTGGGAGCATGTCCTTGG + Intergenic
1190348548 X:49541110-49541132 CTGCTGTGGGAGCATGTCCTTGG + Intergenic
1190349649 X:49550666-49550688 CTGCTGTGGGAGCATGTCCTTGG + Intergenic
1190350753 X:49560219-49560241 CTGCTGTGGGAGCATGTCCTTGG + Intronic
1190351854 X:49569777-49569799 CTGCTGTGGGAGCATGTCCTTGG + Intergenic
1190352955 X:49579326-49579348 CTGCTGTGGGAGCATGTCCTTGG + Intergenic
1190354056 X:49588873-49588895 CTGCTGTGGGAGCATGTCCTTGG + Intergenic
1190355158 X:49598397-49598419 CTGCTGTGGGAGCATGTCCTTGG + Intronic
1190597005 X:52060890-52060912 CTCCTGGGGAAACAGAGGCTGGG + Intergenic
1190611819 X:52193183-52193205 CTCCTGGGGAAACAGAGGCTGGG - Intergenic
1190642502 X:52494561-52494583 CACCTGTAGTAGCAGGGACTGGG + Intergenic
1190645171 X:52518306-52518328 CACCTGTAGTAGCAGGGACTGGG - Intronic
1193265594 X:79464490-79464512 CTCCCGTGGAAGCCTGGCATGGG + Intergenic
1195708057 X:107752438-107752460 CTCCTCTGGAAGCAAGGGATGGG - Intronic
1196495983 X:116326106-116326128 CTTAACTGGAAGCAGGGCCTGGG - Intergenic
1197272023 X:124435179-124435201 CTCCTATGCAAGCAAAGCCTTGG - Intronic
1199807465 X:151314643-151314665 TTGCTATGGAAGCAGGACCTTGG + Intergenic
1200057571 X:153469770-153469792 CTCTTGTGGCAGCAGGACCTAGG + Intronic
1200779619 Y:7202641-7202663 ATCCTGTAGAAGCAGTGGCTAGG - Intergenic
1200858495 Y:7964914-7964936 CCCCAGTGGAAGCAGGGTCCAGG + Intergenic
1200879985 Y:8202554-8202576 CCCATATGGGAGCAGGGCCTGGG + Intergenic
1200896289 Y:8379354-8379376 CCCCAGTGGAATCAGGGTCTAGG + Intergenic
1200905154 Y:8474199-8474221 GTTCTCTGGAAGCAGGGCATAGG - Intergenic
1202245061 Y:22811632-22811654 CTCTAGTGGAAGCAGGGTCCAGG - Intergenic
1202260714 Y:22967426-22967448 CCCCAGTGGAAGCAGGGTCCAGG - Intergenic
1202398051 Y:24445378-24445400 CTCTAGTGGAAGCAGGGTCCAGG - Intergenic
1202413701 Y:24601167-24601189 CCCCAGTGGAAGCAGGGTCCAGG - Intergenic
1202457084 Y:25068919-25068941 CCCCAGTGGAAGCAGGGTCCAGG + Intergenic
1202472730 Y:25224709-25224731 CTCTAGTGGAAGCAGGGTCCAGG + Intergenic