ID: 933894762

View in Genome Browser
Species Human (GRCh38)
Location 2:86800730-86800752
Sequence CTTTCAACAAAATTGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 1, 2: 2, 3: 38, 4: 302}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933894757_933894762 10 Left 933894757 2:86800697-86800719 CCCATGTGCAGGTCAGTGGTTCC 0: 1
1: 0
2: 1
3: 12
4: 124
Right 933894762 2:86800730-86800752 CTTTCAACAAAATTGGAAGAAGG 0: 1
1: 1
2: 2
3: 38
4: 302
933894758_933894762 9 Left 933894758 2:86800698-86800720 CCATGTGCAGGTCAGTGGTTCCC 0: 1
1: 0
2: 0
3: 17
4: 191
Right 933894762 2:86800730-86800752 CTTTCAACAAAATTGGAAGAAGG 0: 1
1: 1
2: 2
3: 38
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933894762 Original CRISPR CTTTCAACAAAATTGGAAGA AGG Intronic
900854107 1:5166978-5167000 CTTTGAACAGAATGGGAAGCAGG + Intergenic
902537208 1:17126553-17126575 TTTACAACCACATTGGAAGAAGG + Intergenic
905008953 1:34733845-34733867 CTTCAAAGAAAATGGGAAGAAGG - Intronic
906666720 1:47627335-47627357 ATTTCAAAAGACTTGGAAGAGGG + Intergenic
906844124 1:49172372-49172394 CCTCCAAAAAAATTGGAAGTGGG + Intronic
907806092 1:57821796-57821818 CTCTTAAAAAAAATGGAAGAAGG - Intronic
907909785 1:58815671-58815693 CCTTCTATAAAATGGGAAGAAGG - Intergenic
908383293 1:63616814-63616836 ATTACATTAAAATTGGAAGAAGG - Intronic
908736289 1:67280161-67280183 CATTCAACAAAATTTTAATATGG + Intergenic
909696185 1:78470596-78470618 CTTGGAACAAAATAGGAAGAGGG + Intronic
909955828 1:81777757-81777779 GTTTCAACAAAATTTTAAAATGG + Intronic
910828333 1:91432956-91432978 ATTTCAACAAAATTAGATTATGG + Intergenic
910979129 1:92941440-92941462 CTGTCAACAGAACTGAAAGAAGG - Intronic
911268568 1:95773463-95773485 CTTAAAACACAATTGGAATAAGG + Intergenic
912760631 1:112363485-112363507 CTTTTTAAAAAACTGGAAGATGG - Intergenic
913048598 1:115095208-115095230 CTTTCAATAAAATTGAAGAAAGG - Intergenic
917270101 1:173263490-173263512 CTTTCAAAAAAATTGCAGGAGGG - Intergenic
917871369 1:179244907-179244929 CTTTTGACAGAAATGGAAGAAGG + Intergenic
918169930 1:181986928-181986950 ATCTCAACAAGATTGGAAAATGG - Intergenic
918764325 1:188458983-188459005 CTTTCCACAGAATTGGAATCAGG + Intergenic
919515128 1:198512979-198513001 TTTTCAACAAAATGACAAGATGG - Intergenic
920963363 1:210683038-210683060 CTTTGCACAATTTTGGAAGAAGG - Exonic
921538531 1:216383535-216383557 ATTTCAACAAAACTGGAATGTGG + Intronic
922290681 1:224206719-224206741 CTTTCAACAGAATGGGAGGTAGG - Intergenic
1062836241 10:637686-637708 CTTTAAACAAAATTAAATGATGG - Intronic
1063631394 10:7736990-7737012 CTTTCAACAAAATTGAAGAAGGG - Intronic
1063884694 10:10565432-10565454 CTTTCAAATGAATAGGAAGAGGG + Intergenic
1064895337 10:20229027-20229049 TTTTCAAGAAAAATGGAAGAAGG + Intronic
1065262675 10:23940988-23941010 CTATCAAGAAACTTGGAAGAAGG - Intronic
1065269264 10:24010541-24010563 CTTTCAAGAAAACTTGAAGGGGG - Intronic
1065350669 10:24793101-24793123 CTTTCTGCAAGATTCGAAGAAGG + Intergenic
1065373497 10:25013591-25013613 CTTTAAACAAAATGGAAAGAGGG + Intronic
1066080154 10:31922563-31922585 CTTTCAAGAAATTTGTTAGAAGG - Intronic
1067707206 10:48616444-48616466 CTTTCATCAAATTTGGAAAGTGG - Intronic
1068818816 10:61349358-61349380 CTTGGAACACATTTGGAAGATGG + Intergenic
1069278833 10:66627595-66627617 CTTTCAACAAAGTTGAAAGCTGG + Intronic
1069430341 10:68329484-68329506 CTTTCAACCGATTTGGCAGATGG - Intronic
1069575427 10:69523963-69523985 TATTCAACAAAATTTAAAGAAGG + Intergenic
1069864243 10:71491676-71491698 GTTTCAGCAAAGTTGGCAGATGG + Intronic
1070578584 10:77700566-77700588 CTTTCAAGAAAATTAAAGGAAGG + Intergenic
1070764114 10:79046788-79046810 CATCCAACAAATTTGGAAAAGGG + Intergenic
1070912132 10:80127890-80127912 CTTTCAAGAATATTGGAAGGAGG + Intergenic
1070985908 10:80689688-80689710 CTTTCAACAATATTGTGAGTTGG - Intergenic
1073390915 10:103175842-103175864 CTTCCACAAAAATTGGAAGGAGG + Intronic
1073890256 10:108092535-108092557 ATTTCACCAACAGTGGAAGAGGG - Intergenic
1073999990 10:109361826-109361848 CTTTAAAAAAAATTACAAGAGGG - Intergenic
1074660480 10:115650235-115650257 CTTTGAACATATTGGGAAGAAGG - Intronic
1074705767 10:116128871-116128893 CTTTGTACAAAGTTGGAACAGGG + Intronic
1075592157 10:123699657-123699679 CTTTCAACAAGAGTTTAAGATGG + Intergenic
1077886001 11:6388558-6388580 CTCACAACAAATTTGGAAGTCGG - Intergenic
1078665991 11:13325728-13325750 TTTTCATCAAAATTTGGAGAGGG - Intronic
1078695908 11:13631319-13631341 ATTTCCACAAAATGGGAAGTTGG + Intergenic
1078896479 11:15601402-15601424 CCTTCAACACATTTGGAAGGAGG + Intergenic
1080071104 11:28087900-28087922 CTTTCAAAAAAATTATAATATGG - Intronic
1080728195 11:34917847-34917869 ATTTCAACAAACTTGGAGGAGGG - Intronic
1081514160 11:43808611-43808633 CTATACATAAAATTGGAAGAGGG - Intronic
1082183722 11:49153190-49153212 ATTTGAACAAAATTTTAAGATGG - Intronic
1082647358 11:55744526-55744548 CTTTCAAGATAATTGTGAGATGG + Intergenic
1082920610 11:58488639-58488661 CTTTCCAGGGAATTGGAAGAGGG + Intergenic
1085158162 11:74315114-74315136 CAATCAAGAAAATTTGAAGAAGG - Intergenic
1086682634 11:89692196-89692218 ATTTGAACAAAATTTTAAGATGG + Intergenic
1087403895 11:97704454-97704476 CTTTCAGCAAATTTGTAATATGG + Intergenic
1087480803 11:98698298-98698320 CTTTCAAGACAATGGGAAAAAGG - Intergenic
1088129450 11:106470021-106470043 CTTTCAACAAACATGAAAAATGG + Intergenic
1088244143 11:107800536-107800558 CTGTCAAGAAAATAGGAAGCAGG + Intronic
1088502867 11:110500412-110500434 CTGTCAAGAAAATTGAAAGGAGG - Intergenic
1089622900 11:119732070-119732092 GAATCAACAAAATTGGAACATGG - Intergenic
1090917610 11:131179807-131179829 GTCTCAACAATCTTGGAAGATGG - Intergenic
1091482781 12:851258-851280 CTTTCAAAATGATTGGAGGAAGG + Intronic
1091902266 12:4153785-4153807 CTTTCAACAAAACTGGGTGGGGG + Intergenic
1092561379 12:9617642-9617664 CCATCCACAGAATTGGAAGATGG - Intergenic
1093239208 12:16648359-16648381 CTTTAAACAAAATTTTAAGCTGG - Intergenic
1093263321 12:16968512-16968534 CTCTCAGCAAAATAGGAATATGG + Intergenic
1093706213 12:22277305-22277327 ATAACAACAAAATTGGCAGAGGG + Intronic
1096713944 12:53479767-53479789 TTTTCAAAAAAATTAAAAGATGG + Exonic
1097599707 12:61675822-61675844 GTTTCCACAAAATTTGCAGAAGG - Intergenic
1098345581 12:69499534-69499556 CTTTCTCCAAAATTGGAGGGTGG - Intronic
1101414256 12:104495306-104495328 CTTTCAAAAGAATTGAAAGCAGG - Intronic
1103664157 12:122548618-122548640 CATTCAACAGAGTTGGAATATGG + Intronic
1105287547 13:19018081-19018103 TTTTCTACAAAATTGGAAGTAGG - Intergenic
1106336719 13:28790048-28790070 CTTTCACAAAAATTTGAAAAGGG - Intergenic
1106667227 13:31864515-31864537 CTTTCAACAAACCTTGAAGTAGG - Intergenic
1109098554 13:58148346-58148368 GTTGAAAGAAAATTGGAAGAGGG - Intergenic
1109557703 13:64002518-64002540 CTTTAATGAAAATTGGAAGCTGG - Intergenic
1110455984 13:75690768-75690790 TTTTCAATAAAATTGGAAATGGG + Intronic
1111664575 13:91250768-91250790 CTTTCAACAAAAGTGATAGTAGG + Intergenic
1112295270 13:98180611-98180633 ATCTCAACTAACTTGGAAGAAGG - Intronic
1115415566 14:33128893-33128915 TTTTCATCAAAACTGGAAAATGG + Intronic
1116213941 14:41986274-41986296 TTGTCAACACAATTGCAAGAAGG + Intergenic
1116301063 14:43184274-43184296 CTTTCAACAAACTGGGAATAAGG + Intergenic
1117292594 14:54347972-54347994 CTTTCAACAAAACTGTAACCAGG + Intergenic
1118193315 14:63600933-63600955 CTGTCTTCAAAAGTGGAAGAGGG + Intronic
1119625976 14:76175949-76175971 ATTTCCAAAAAATTGGAAAACGG - Intronic
1120178802 14:81322649-81322671 CTTTCCTGAAACTTGGAAGAGGG + Intronic
1121614472 14:95303870-95303892 GTTTCAATAAAGTTGGGAGATGG - Intronic
1123673324 15:22683057-22683079 CTCTCAACAAAATGAGAAAAGGG - Intergenic
1124219520 15:27837413-27837435 CTTTCGACATAACTAGAAGATGG + Intronic
1126193811 15:45908339-45908361 CTTTTAATAAAATTGCAAGAAGG - Intergenic
1126288633 15:47045555-47045577 TTTTAAACAAAATTGTGAGATGG - Intergenic
1126488472 15:49209870-49209892 CTTGCAAAAAAATTGAAAGGCGG - Intronic
1127405711 15:58643442-58643464 GTTTAAATAAAATTGGAAGTTGG - Intronic
1127482378 15:59389552-59389574 TATTCAACAAAATTTGAAGTAGG - Intronic
1128163191 15:65438223-65438245 CTTACAAACAAATTGGTAGATGG + Intergenic
1130891128 15:88135041-88135063 CTTTCTACAAGCTTGGGAGATGG - Intronic
1131245482 15:90788271-90788293 CTGTCTTCAGAATTGGAAGAAGG + Intronic
1131416361 15:92262642-92262664 CTTTCAATAGAATGGGAAGCAGG - Intergenic
1131521888 15:93122632-93122654 TTATCAAAAAAATTGGAAAAAGG - Intergenic
1133524446 16:6590690-6590712 CTTTCTAGAAAATGGGAGGAGGG + Intronic
1133671937 16:8031214-8031236 CTTTCAACAAATGGGGGAGAAGG + Intergenic
1134088642 16:11376594-11376616 CTTTCAACAAATTTTGAAATTGG + Intronic
1137070942 16:35904213-35904235 CCCTCCACAAAATTGGATGACGG - Intergenic
1138290926 16:55846222-55846244 TCTTCAATAAATTTGGAAGAGGG - Exonic
1138904120 16:61309893-61309915 ATTTAAAAAATATTGGAAGATGG + Intergenic
1138995141 16:62442145-62442167 CTTACACCAAAATTGAAAAAAGG + Intergenic
1139575682 16:67840742-67840764 GTTTAAAAAAAATTGGGAGAAGG + Intronic
1141495251 16:84405309-84405331 CTTCCATCAACATTGAAAGATGG - Intronic
1143913896 17:10274911-10274933 CGTTGAACAAGACTGGAAGAAGG + Intergenic
1146104215 17:30016561-30016583 ATTTTATGAAAATTGGAAGAGGG - Intronic
1149102619 17:52924282-52924304 CTTTCAGCAAAATTGGGGCATGG + Intergenic
1149361822 17:55903196-55903218 CTTGAAACAAAATGGGAAAATGG + Intergenic
1150660282 17:67069368-67069390 CTTTCATCAAAACTGCAAGATGG - Intergenic
1152105899 17:78328843-78328865 CTTAGAAAAAAATTGGGAGAGGG + Intergenic
1152508201 17:80767029-80767051 CTTTCATCAGAAATGAAAGAGGG + Intronic
1153291581 18:3506951-3506973 ATTTCTGAAAAATTGGAAGAAGG + Intronic
1153799137 18:8653695-8653717 CTTTCAACAAGTTTGGAAAGAGG + Intergenic
1154047482 18:10920546-10920568 TTTCCAACAAAATTGCATGAAGG - Intronic
1154173308 18:12066660-12066682 TTTTCAGCAAAATTGCATGAAGG + Intergenic
1154235969 18:12606065-12606087 TTTTAAACAAAATTGAAAAATGG + Intronic
1156001417 18:32388859-32388881 CAATCAACAAAACTGGAACATGG + Intronic
1156608644 18:38699644-38699666 ATATCAACAAAAATGAAAGAGGG - Intergenic
1157127274 18:44968664-44968686 CATACAACAAAATTGAAAGATGG - Intronic
1157393806 18:47325551-47325573 CTTTCAACCCAACTGGGAGAAGG - Intergenic
1158947462 18:62459465-62459487 CTGTCAACAAAAGTGGAAGAAGG - Intergenic
1159237071 18:65689828-65689850 ATTTCCAAAAAATTGAAAGAAGG - Intergenic
1159252730 18:65901879-65901901 CTATCAACATAATTTGAATAAGG + Intergenic
1160968928 19:1758864-1758886 ATTTAAACAATATTTGAAGACGG - Intronic
1161882643 19:6967493-6967515 CTTTCAACAAAATTCTCAGAGGG + Intergenic
1162897973 19:13776712-13776734 CTTTGAAGAGAGTTGGAAGAAGG - Intronic
1168555334 19:57334075-57334097 ATTTCATCAAAAGTGGCAGAGGG + Intergenic
925955634 2:8961348-8961370 CTTTAAAGAAAATTGGACAATGG + Intronic
928901657 2:36324451-36324473 CTGTCCACAAAATTGAAAGGTGG + Intergenic
929080089 2:38113861-38113883 ATTTAAATACAATTGGAAGAGGG - Intergenic
930172134 2:48262792-48262814 CACTCTACAAAATAGGAAGATGG - Intergenic
930689688 2:54347948-54347970 ATTTTAACAAATTTGGAAGCTGG - Intronic
931018606 2:58016181-58016203 CTTATAACAAAACTGTAAGATGG - Intronic
931527904 2:63178246-63178268 CTTCCAAAAAAATTAAAAGAAGG - Intronic
931927771 2:67093560-67093582 CTTTCATCAGAAGTGTAAGAAGG + Intergenic
932119438 2:69084729-69084751 CTTTAAATAAAAATGGAATATGG - Intronic
932880822 2:75500239-75500261 TTTTCAACAAAACTGAAGGAAGG + Intronic
933894762 2:86800730-86800752 CTTTCAACAAAATTGGAAGAAGG + Intronic
934147686 2:89111513-89111535 CTATCAGCAACCTTGGAAGATGG + Intergenic
934221589 2:90089088-90089110 CTATCAGCAACCTTGGAAGATGG - Intergenic
934791548 2:97066623-97066645 CTTTGAACAGAATGGGAAGTAGG + Intergenic
934814890 2:97315920-97315942 CTTTGAACAGAATGGGAAGTAGG - Intergenic
934822805 2:97392563-97392585 CTTTGAACAGAATGGGAAGTAGG + Intergenic
935270558 2:101430974-101430996 TCTTCAACTAAATTGGAGGAAGG + Intronic
935534524 2:104278229-104278251 CTTTCAGCAAAACTGGGATAAGG + Intergenic
936993607 2:118391276-118391298 CATTCTACAAAATGGGGAGAAGG + Intergenic
937729172 2:125206497-125206519 ATATCACCAAAATTGAAAGATGG - Intergenic
937819838 2:126297332-126297354 ATTTCAACAGTATTGGAAGGTGG - Intergenic
938411350 2:131067313-131067335 CTTATATCACAATTGGAAGAGGG + Intronic
938986151 2:136578555-136578577 CTGTTAACAGAATTTGAAGAAGG + Intergenic
939206429 2:139110060-139110082 CTTCCAAAAAAAATTGAAGAGGG - Intergenic
939407145 2:141772943-141772965 CTTTTAACAAAAGAGGAGGAAGG - Intronic
939822153 2:146970481-146970503 CTTCCCACAACAGTGGAAGACGG + Intergenic
940385131 2:153062552-153062574 TTTTCACTAAAGTTGGAAGATGG - Intergenic
940761124 2:157740523-157740545 CTTTCAGAAAAATTGAGAGATGG - Intronic
940772773 2:157856882-157856904 TTTTCAACAGGATTGAAAGAAGG - Intronic
941426424 2:165351030-165351052 CTTTCAACAACCTTGTAAGCTGG + Intronic
942018796 2:171845766-171845788 CAATCAGCAAAGTTGGAAGAAGG + Intronic
943548156 2:189307273-189307295 CTTTAAACAAAATCGAAATATGG + Intergenic
945178543 2:207067937-207067959 TAATCAACAAAATTGGAGGAAGG - Intergenic
1169839873 20:9923488-9923510 CTTTCAGCAAAATTGACGGAGGG - Intergenic
1170275759 20:14584989-14585011 CTTTCAACAAAGTTGGTCTAAGG + Intronic
1170935710 20:20807184-20807206 CTTTGTACAAAATTGTAAGCAGG - Intergenic
1171287947 20:23957644-23957666 CTTTGCACAGAAGTGGAAGAAGG - Intergenic
1173302429 20:41816116-41816138 CTTTCTAGAAACTTGTAAGACGG + Intergenic
1173441546 20:43081539-43081561 CTTTGAAAAAATTAGGAAGATGG - Intronic
1173734619 20:45350526-45350548 CTTTCCACAAAATTGCAGGGGGG + Intergenic
1174220691 20:48952571-48952593 TTTTCAAATAAATTGTAAGATGG - Intronic
1175386095 20:58596202-58596224 CATTCTATAAAATTAGAAGAAGG - Intergenic
1177189482 21:17834172-17834194 ATTACAACAACATTTGAAGAAGG - Intergenic
1177333477 21:19693109-19693131 GCTTGAACAAAATTGCAAGAGGG + Intergenic
1177552904 21:22648816-22648838 CTTTCAACAATATTTGACAAAGG - Intergenic
1177681092 21:24372331-24372353 TTCTCAACAAGAGTGGAAGAAGG - Intergenic
1178615166 21:34126660-34126682 CTTTCAACAAAAAAGGCAAAAGG - Intronic
1179074555 21:38107611-38107633 TTTTTCACAAAATTGGAACAGGG - Intronic
1182244254 22:28943003-28943025 CTTTCAACATACCTGCAAGATGG - Intronic
1182838329 22:33362849-33362871 CTTCCAAAACAATTGGAGGACGG - Intronic
1183438157 22:37807405-37807427 CTTTAAAATAAATTGGAAAAGGG + Exonic
1185052748 22:48562447-48562469 CTTTCTAGAAAATGGGAAGGGGG + Intronic
951778089 3:26332660-26332682 CTTTAAACAAAATATGGAGATGG + Intergenic
952237544 3:31495664-31495686 CTTTAGACAAAATTGGAAGAAGG - Intergenic
954261883 3:49445109-49445131 TTTTTGACAAGATTGGAAGATGG - Intergenic
954483585 3:50824922-50824944 TATTAAACAAAATTGCAAGAAGG - Intronic
955311939 3:57897229-57897251 CTTTTAACATAATTAGAATAAGG + Intronic
955758842 3:62256160-62256182 CTTTCAACAAAATTGGTTACAGG + Intronic
955957478 3:64305310-64305332 CTTTCATTAAAATTGGAGCAAGG + Intronic
956596636 3:70974169-70974191 GATTCAAAAAAGTTGGAAGAAGG + Intronic
957801646 3:85092160-85092182 CTATCAACAAAATTCAAAAATGG - Intronic
957828253 3:85479423-85479445 CTTACAACAAACTTTAAAGATGG + Intronic
958663233 3:97099948-97099970 CTTAGCACAAAATTGGAAGTTGG + Intronic
960412081 3:117339729-117339751 CTTTTAACAAAATGGTAAAATGG - Intergenic
961056874 3:123796511-123796533 CTATCAACAACATTAGAAGATGG + Intronic
961172444 3:124807481-124807503 CTTTTAACAAGATTGAAAGAAGG - Intronic
963105862 3:141646573-141646595 TTTTCAACAAAATTGTTAGAAGG + Intergenic
963371846 3:144411588-144411610 CTCTCCATAAAATTGGAAGAGGG - Intergenic
963415153 3:144985221-144985243 CTTTCAAGAAAACTGAAAGAAGG + Intergenic
963706916 3:148698878-148698900 CATTTAAGAAAATTGGAGGATGG - Intronic
964335678 3:155651773-155651795 CTATCAATAAAATTGAAAGAAGG - Intronic
964400683 3:156294852-156294874 CTTTCACCAGAATTTGAAAATGG + Intronic
964469829 3:157040920-157040942 ATTTCAAAAACAGTGGAAGAAGG - Intronic
965233171 3:166079639-166079661 TTTTAAAGAAAATTGGAAAAGGG + Intergenic
965508146 3:169538839-169538861 CTTTGAACAAAATTTGAATAGGG - Intronic
966638147 3:182158341-182158363 AATTCAACAAAATTGAAAGAGGG - Intergenic
967413329 3:189189464-189189486 ATTTTAAAAAAATTGGAATAAGG + Intronic
967771850 3:193342594-193342616 CTTTCAACAAATGTGCAAAATGG - Intronic
969307214 4:6332691-6332713 CTTTCCACCAAATAGGATGATGG + Intronic
970151005 4:13089917-13089939 CTCTCAACAAAAATGCAATATGG - Intergenic
970417485 4:15873774-15873796 CCTTAAACAAAATAGTAAGAAGG - Intergenic
971501766 4:27326043-27326065 CTTTAAACTAAATTGGAGGAAGG - Intergenic
971646367 4:29210122-29210144 CTTTCAAGAAAATTGCTAGTTGG + Intergenic
971984135 4:33797762-33797784 ATGTCAACAATATTGTAAGATGG - Intergenic
972074593 4:35070112-35070134 CTTGCAAAAATATTGCAAGATGG - Intergenic
972221707 4:36963471-36963493 CTTTGAACAGAATGGGAGGAAGG + Intergenic
972601582 4:40577578-40577600 TTTTTAAAAAAATTGGAACAGGG - Intronic
976392687 4:84522040-84522062 CTTCCAAAAAAGCTGGAAGAAGG - Intergenic
977300556 4:95262232-95262254 CTTTCATCAAAACTGAAGGAGGG + Intronic
977769851 4:100845431-100845453 CTTGCAGCAAAATGGGAAGCTGG - Intronic
978045163 4:104116301-104116323 CTTTAAAAAAAATTGGAATCAGG + Intergenic
982375313 4:154683775-154683797 CCTTCAACCAAAATGGGAGAAGG - Intronic
983977057 4:173947970-173947992 CTTTTAAAAAAATGGGAAGCAGG - Intergenic
984144153 4:176040819-176040841 ATTTCAAAAAATTTGGGAGAAGG - Intergenic
984171007 4:176359138-176359160 CTTTAAACAGAATAGGAAGCAGG + Intergenic
984544506 4:181085270-181085292 CATTCTACAAAATTGGGAAATGG + Intergenic
984714106 4:182910865-182910887 CTTGTAACATAATAGGAAGATGG - Intronic
987168641 5:15228507-15228529 CTTGCAAAAATATTAGAAGAGGG - Intergenic
987996678 5:25291197-25291219 TTTTCAACAACAGTGGAAAATGG + Intergenic
988401995 5:30775108-30775130 CTTTCAACAAAATTTGGAAGTGG + Intergenic
989171628 5:38475836-38475858 CTTTCAACATACTTTTAAGATGG + Exonic
989586967 5:43082029-43082051 CAATAAACTAAATTGGAAGATGG + Intronic
989989486 5:50744203-50744225 CTTTCAAAAGTAGTGGAAGATGG - Intronic
990150011 5:52806492-52806514 CATTCAAAAACATTGGGAGAAGG + Intronic
992246857 5:74834820-74834842 CTTTCAACAAAATTCTAAATCGG + Intronic
993237955 5:85339578-85339600 CTTTCAACAAAAGTGTGATATGG - Intergenic
993445468 5:88006643-88006665 CTTTCAAATAAATTGTAAGAAGG - Intergenic
994284902 5:97953050-97953072 CTTTCAACAAAATTTGGAATTGG + Intergenic
994829960 5:104768150-104768172 TTTTGAAGAAAATTGGAAGAAGG - Intergenic
995391324 5:111642936-111642958 CTTTCAACAATATTGGGAACTGG + Intergenic
997460816 5:134051111-134051133 CCTTCAAGGAAACTGGAAGAAGG - Intergenic
999064482 5:148671112-148671134 AGTTCAACAAAATTGATAGACGG - Intronic
999551723 5:152694886-152694908 CTTTTAACAAAAATGGAGAAGGG - Intergenic
999859633 5:155632138-155632160 TTTTCAACAAAAGCTGAAGAGGG - Intergenic
1000713459 5:164609016-164609038 CTTTAAAAAAAATGGGAAAATGG - Intergenic
1001647416 5:173292448-173292470 CTTTCAACACAATGGCAAGATGG - Intergenic
1001738224 5:174024760-174024782 CTTTCGTCAGAATTGGAAGTAGG - Intergenic
1002084739 5:176766816-176766838 CTTGCACCAAAATTGACAGATGG - Intergenic
1002812166 6:641075-641097 GTTTAAACAAAATTGAAATAAGG + Intronic
1003804585 6:9712900-9712922 CTTTAAAAAAAAATGGAAGAAGG + Intronic
1003849231 6:10204830-10204852 CTTGCTAGAAAATTGGAAAAGGG - Intronic
1004159803 6:13203575-13203597 CTTTCCACAGAGTGGGAAGAGGG + Intronic
1004208004 6:13610395-13610417 CTTTCAATAAAGTTGAAAGAGGG - Intronic
1004318666 6:14614941-14614963 CATTTAACCAACTTGGAAGATGG - Intergenic
1004573164 6:16867715-16867737 CTTTCATCAAAAATGAATGATGG + Intergenic
1005198814 6:23319622-23319644 CTGTGAACAAATTTGGAACATGG - Intergenic
1008247027 6:49189089-49189111 CTTTTAATAAAATTAAAAGATGG + Intergenic
1008862051 6:56160590-56160612 GTTTCAACTAAATTAGAATAAGG - Intronic
1009411838 6:63374360-63374382 CTGTCAACAAAATTTGCAGAAGG - Intergenic
1009941332 6:70291940-70291962 CTTGCAACAACCTTGTAAGATGG - Intronic
1010373199 6:75135514-75135536 CTTTCAACAAGATAGCTAGATGG - Intronic
1013879916 6:114885000-114885022 CTTTATAAAAAATTGGAAAATGG - Intergenic
1013967041 6:115967255-115967277 CTAGGAACAAAATGGGAAGAAGG + Intronic
1014015749 6:116528047-116528069 TTATGAACAAAAATGGAAGATGG + Intronic
1017685611 6:156910916-156910938 TTTTAAACAAAATTAGAATAAGG + Intronic
1020759522 7:12251130-12251152 CTTCCAACTAAAGTGGAAAAAGG + Intergenic
1021051286 7:15988424-15988446 CTTTCATAAAAATAGGGAGATGG - Intergenic
1021465742 7:20941631-20941653 TTTTCCAAAAAAATGGAAGAGGG + Intergenic
1021772033 7:24013868-24013890 CTTCCAAAAAAAATGGAAGAGGG + Intergenic
1022592225 7:31675287-31675309 CTTTGCACAAATCTGGAAGAAGG - Intergenic
1022825633 7:34009904-34009926 ATTTCAACAAAAATATAAGACGG - Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1025311146 7:57943667-57943689 GGATCAACAAAATTGGTAGACGG - Intergenic
1027931728 7:84545681-84545703 CTTTCAACAAAATTGAAAGATGG - Intergenic
1028234820 7:88347800-88347822 CTTTCACCAAGATGGGGAGAGGG - Intergenic
1028682193 7:93548371-93548393 CTTTCAACAACATTGTAGGAGGG + Intronic
1028715600 7:93963778-93963800 CTTTAAAAAAAATTGAAAAAAGG + Intronic
1031000323 7:116408049-116408071 CTTTGAAACAAATTGAAAGATGG - Intronic
1031744219 7:125473093-125473115 CTTTAAACAAAATTGTAAAAAGG - Intergenic
1032258963 7:130319337-130319359 ATTGTAACAAAATTGGAGGAAGG - Intronic
1032504175 7:132423448-132423470 CCATCAGCAAAATGGGAAGAGGG - Intronic
1035828936 8:2674009-2674031 TTTTCTACAAAATCGGAAGATGG + Intergenic
1036907989 8:12723851-12723873 TTTTGAACAACATTGGAAGCTGG - Intronic
1037202966 8:16280552-16280574 TTATAAACAAAATTGGAAGTGGG - Intronic
1038380413 8:27087566-27087588 TTTTCCACAAAATTAGAATAAGG - Intergenic
1039345894 8:36704850-36704872 CTTTAAAAAACACTGGAAGAAGG + Intergenic
1039612158 8:38928568-38928590 CTGTCACCAGAGTTGGAAGACGG + Intronic
1039624066 8:39029559-39029581 ATCTCAACAAACTAGGAAGAGGG - Intronic
1040624215 8:49127213-49127235 CTTTCAGCAAACTAGGAATAAGG - Intergenic
1040735806 8:50507360-50507382 CTTTCAAAAAAATTTGATGAGGG - Intronic
1041479686 8:58306202-58306224 TTTTAAAAAAAATTGGAACAAGG + Intergenic
1043254183 8:78111981-78112003 CTTTAAATAAAGTTGGGAGAAGG + Intergenic
1043271359 8:78338328-78338350 CATTCATCAAAATTGTAAAATGG - Intergenic
1043354053 8:79391884-79391906 CTCTCCACAACATTGGAAGTTGG + Intergenic
1043989614 8:86736705-86736727 CTTTTAAACAAATTTGAAGATGG + Intronic
1046004378 8:108461679-108461701 CTTTAAAAAAGATGGGAAGAAGG - Intronic
1046296514 8:112226756-112226778 ATTTCAACAAAAATGGACAAAGG + Intronic
1047345660 8:124025948-124025970 CTTCAAAGAAAATTAGAAGAAGG + Intronic
1048746293 8:137618057-137618079 CCTTCATCAAAATTGGAAAAGGG - Intergenic
1050078185 9:1887248-1887270 ATTTGATCAAATTTGGAAGAAGG + Intergenic
1050118238 9:2282313-2282335 TTTTCTACAAAGTTGGAGGAAGG + Intergenic
1050277755 9:4017783-4017805 TTTTCAACAATATTGAAGGACGG + Intronic
1050917270 9:11152923-11152945 CTTCCAAAAAAAATGGAAAAAGG + Intergenic
1051777221 9:20648761-20648783 CTTTTAAAAAAATTGGGGGATGG + Intergenic
1051824269 9:21201615-21201637 TTTTCAACAAACTTGAAAAAAGG - Exonic
1051825709 9:21216755-21216777 TTTTCAACAAACTTGCAAAAAGG - Exonic
1051920263 9:22256806-22256828 CTCTGCACAAAATTGGAGGATGG + Intergenic
1051949848 9:22618509-22618531 ATTTCAATAATATTGGAAGTGGG + Intergenic
1055351947 9:75398763-75398785 CTTTGAAAAAAATTGGGAGATGG - Intergenic
1056283498 9:85064769-85064791 CGTTTACCAAAATTGGAGGAAGG + Intergenic
1056465143 9:86846524-86846546 CGTGCAACAAAAATGGAGGAAGG + Intergenic
1059230424 9:112716482-112716504 CTTGAAACAAAATAGGAAAATGG - Exonic
1061222052 9:129258013-129258035 CTGTCGACAAACTGGGAAGATGG - Intergenic
1061910830 9:133722330-133722352 CACTTAACAAACTTGGAAGAAGG + Intronic
1186397797 X:9227274-9227296 ATTTGAACAGAATAGGAAGAAGG + Intergenic
1186965131 X:14778785-14778807 CTTTCAACAGAATTTGGAAATGG + Intergenic
1187041717 X:15603493-15603515 GTTTCAAAAAGATTGGAGGAGGG + Intergenic
1187573912 X:20533862-20533884 CTGTCAAAGAAATTTGAAGAAGG - Intergenic
1188328250 X:28834499-28834521 CTTTCTACAGAATTATAAGAAGG - Intronic
1188918231 X:35938826-35938848 CTTTCATCAACATTAAAAGAGGG - Intronic
1189159489 X:38796854-38796876 CAAGCAACAAAACTGGAAGATGG - Intergenic
1192284352 X:69718835-69718857 CTTCCAGAAAAATAGGAAGAAGG - Intronic
1192312176 X:70026191-70026213 CTTTCCATAAAATTGTGAGAAGG + Intronic
1193397061 X:80997822-80997844 ATTTTAACAATATTGGAATATGG - Intergenic
1193466816 X:81858541-81858563 CTTTCAATGAAATTGTAAGGGGG - Intergenic
1193718752 X:84963611-84963633 CTAACAAAAAAGTTGGAAGATGG - Intergenic
1195023393 X:100851449-100851471 ATTTCACCAAATCTGGAAGATGG + Intronic
1195512518 X:105733893-105733915 CTTTCAACAAAAAAGTAACAAGG - Intronic
1195533823 X:105987702-105987724 CTTTCTAGGAAATTGGAAGGCGG + Intergenic
1196003822 X:110814186-110814208 TTTTCAATAAAATTTGAAGGTGG + Intergenic
1196752566 X:119130999-119131021 AATTCAACAACCTTGGAAGAAGG - Intronic
1197195049 X:123691369-123691391 CTTTCAAAGAAATAGGAAAAAGG + Intronic
1197530278 X:127615602-127615624 CTTTAAACAAAATTGGAATTGGG + Intergenic
1198521552 X:137458495-137458517 CTTTTAACAAAATTGAAGAAGGG - Intergenic
1201269822 Y:12243856-12243878 CTTTGAATACAATTGGAAGCAGG - Intergenic