ID: 933897446

View in Genome Browser
Species Human (GRCh38)
Location 2:86824573-86824595
Sequence TCCCCACAGGACCCCAGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 300}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933897446_933897463 30 Left 933897446 2:86824573-86824595 CCCTTCCTGGGGTCCTGTGGGGA 0: 1
1: 0
2: 1
3: 27
4: 300
Right 933897463 2:86824626-86824648 GAAGAGAGAGGGAGGCCTTGTGG 0: 1
1: 0
2: 4
3: 66
4: 670
933897446_933897456 7 Left 933897446 2:86824573-86824595 CCCTTCCTGGGGTCCTGTGGGGA 0: 1
1: 0
2: 1
3: 27
4: 300
Right 933897456 2:86824603-86824625 TTTCATCAGTGCCCTGGGTCAGG 0: 1
1: 0
2: 1
3: 17
4: 199
933897446_933897457 8 Left 933897446 2:86824573-86824595 CCCTTCCTGGGGTCCTGTGGGGA 0: 1
1: 0
2: 1
3: 27
4: 300
Right 933897457 2:86824604-86824626 TTCATCAGTGCCCTGGGTCAGGG 0: 1
1: 0
2: 2
3: 13
4: 152
933897446_933897459 18 Left 933897446 2:86824573-86824595 CCCTTCCTGGGGTCCTGTGGGGA 0: 1
1: 0
2: 1
3: 27
4: 300
Right 933897459 2:86824614-86824636 CCCTGGGTCAGGGAAGAGAGAGG 0: 1
1: 0
2: 9
3: 68
4: 540
933897446_933897462 22 Left 933897446 2:86824573-86824595 CCCTTCCTGGGGTCCTGTGGGGA 0: 1
1: 0
2: 1
3: 27
4: 300
Right 933897462 2:86824618-86824640 GGGTCAGGGAAGAGAGAGGGAGG 0: 1
1: 0
2: 12
3: 182
4: 1579
933897446_933897461 19 Left 933897446 2:86824573-86824595 CCCTTCCTGGGGTCCTGTGGGGA 0: 1
1: 0
2: 1
3: 27
4: 300
Right 933897461 2:86824615-86824637 CCTGGGTCAGGGAAGAGAGAGGG 0: 1
1: 0
2: 9
3: 67
4: 664
933897446_933897455 2 Left 933897446 2:86824573-86824595 CCCTTCCTGGGGTCCTGTGGGGA 0: 1
1: 0
2: 1
3: 27
4: 300
Right 933897455 2:86824598-86824620 GGGCTTTTCATCAGTGCCCTGGG 0: 1
1: 0
2: 1
3: 15
4: 138
933897446_933897454 1 Left 933897446 2:86824573-86824595 CCCTTCCTGGGGTCCTGTGGGGA 0: 1
1: 0
2: 1
3: 27
4: 300
Right 933897454 2:86824597-86824619 GGGGCTTTTCATCAGTGCCCTGG 0: 1
1: 0
2: 1
3: 14
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933897446 Original CRISPR TCCCCACAGGACCCCAGGAA GGG (reversed) Intronic
900852024 1:5151442-5151464 CCAGCACAGGACCCCAGCAAAGG - Intergenic
900986514 1:6076317-6076339 TGCTCACAGGAGCCCATGAAGGG + Intronic
901210208 1:7520311-7520333 ACCCCACAGGACCCTGGGAGAGG - Intronic
902811942 1:18892912-18892934 TCTCCACAGTCCCTCAGGAAGGG + Intronic
902877905 1:19352030-19352052 ACCCCACAGGACACGAGGAGCGG + Intronic
903773217 1:25777245-25777267 GCCCCAGAGGACCCCAGCCATGG + Intronic
904806217 1:33134244-33134266 TCCTCACAGCAACCCAGCAAGGG + Intergenic
905824993 1:41020596-41020618 TCACCCCAGGACTCCATGAAGGG + Exonic
906292133 1:44626209-44626231 TCCCCAAAGCACCACAGGACTGG + Intronic
906331630 1:44889933-44889955 TCCTCATAAAACCCCAGGAATGG + Intronic
907300484 1:53483766-53483788 GCCTCACAGCAGCCCAGGAAAGG - Intergenic
907475465 1:54702276-54702298 CGCCCACAGGACCCGAGGGAGGG - Intronic
910648193 1:89535982-89536004 AACCCAGAGGGCCCCAGGAAAGG - Intronic
912439234 1:109686202-109686224 TCCCCACAGGACCACAGGCAGGG - Intronic
912442547 1:109710644-109710666 TCCCCACAGGATCACAGGCAGGG - Intergenic
915737573 1:158094635-158094657 TGCCCCCAGGACCCCACCAATGG + Exonic
916470523 1:165118487-165118509 CCCCCACAGCATGCCAGGAAGGG + Intergenic
917329728 1:173868611-173868633 CTCCCTCAGGACCCCGGGAAGGG + Intronic
920309431 1:205040110-205040132 TCCCCACTTGTCCCCAGGGATGG + Intergenic
920698887 1:208202994-208203016 TCCCCAGCAGACCCCAGGGAAGG - Intronic
920854262 1:209650738-209650760 TCCCCAAAGGCCCAAAGGAATGG + Intronic
922822737 1:228495115-228495137 TCCCCCCAGGCCCCAAGGAAAGG - Exonic
923765539 1:236889658-236889680 TGTCCACAGGAGCCCAGGCAGGG - Intronic
924225578 1:241919066-241919088 TCCTCACAGGACATCAGGGAAGG - Intergenic
1063159335 10:3408300-3408322 ACCCCACAGGACCCCCTGCAAGG - Intergenic
1063159371 10:3408400-3408422 ACCCCACAGGACCCCCTGCAAGG - Intergenic
1063167526 10:3477261-3477283 TGACCACAGGGCCCCAGGACAGG + Intergenic
1064860204 10:19817442-19817464 TCCCCAAAGTAGCCCAGGGAGGG + Intronic
1065322807 10:24524669-24524691 TCCCCACAGATACCCATGAATGG + Exonic
1067752736 10:48982681-48982703 TCCCCACAGTTCTCAAGGAAGGG + Exonic
1069636716 10:69929600-69929622 TCCCCACCTGACCCAAAGAAGGG + Intronic
1069636892 10:69930438-69930460 TCCCCAAGGCCCCCCAGGAAAGG + Exonic
1069853131 10:71423477-71423499 TCCTCACAGGAGCCCAGCCAAGG - Intronic
1070724803 10:78780629-78780651 GCCTCACAGGAGCCCAGGCAAGG + Intergenic
1071218739 10:83437498-83437520 CCCCCAGAGGAACACAGGAAAGG + Intergenic
1071469736 10:85975333-85975355 TCCCCACAGTCAGCCAGGAAAGG - Intronic
1072734128 10:97867616-97867638 GCCCCACAGGGGCCCAGGGAGGG - Exonic
1073379172 10:103065056-103065078 TCCAGACAGGATCCCAGGCAGGG - Intronic
1073442683 10:103561929-103561951 TCTCCACCGGACACCAGAAAGGG + Intronic
1074579443 10:114704681-114704703 ACCCCACAGCCTCCCAGGAAGGG - Intergenic
1075782398 10:125026038-125026060 TCCCCCCAGGTCCCCAGGCAGGG + Intronic
1077117208 11:890533-890555 TGACCTCAGGAACCCAGGAAGGG - Intronic
1077184144 11:1228907-1228929 CCACCCCAGGACCCCAGGAGGGG + Intronic
1077224765 11:1435147-1435169 TCACCCCAGGACACCAGGACGGG - Intronic
1077371243 11:2182565-2182587 GCCCCACAGGTCCCCAGCAGCGG + Intergenic
1077550558 11:3198219-3198241 TCCCCAGAGGACCCCTGGGCTGG - Intergenic
1078928352 11:15894251-15894273 TCAGCAGAGGATCCCAGGAAGGG + Intergenic
1079882551 11:25944826-25944848 TTCCCACATGCCCCCAGGATAGG + Intergenic
1081977610 11:47245644-47245666 TCCCCTCACCACCCCAGGGAAGG + Intronic
1084353230 11:68618582-68618604 TCCCAACAGGACCCCGTGACTGG - Intergenic
1085121416 11:73969862-73969884 TACTCACATAACCCCAGGAAGGG - Intronic
1085245639 11:75098491-75098513 GCCGCACAGGAGCCCAGGGAGGG - Intergenic
1085389626 11:76175804-76175826 TCCCACCACCACCCCAGGAATGG - Intergenic
1085796277 11:79542930-79542952 TCCTCAGAGGGACCCAGGAATGG - Intergenic
1090274199 11:125408352-125408374 CTCCCACGGGGCCCCAGGAAGGG + Intronic
1090374386 11:126278668-126278690 TCCCTGCAGGAACTCAGGAATGG - Intergenic
1090662425 11:128891556-128891578 TGCCCACAGGACCCCACAACAGG + Exonic
1091331731 11:134736184-134736206 TTCCCACGGGCCCCCAGGAATGG - Intergenic
1091347589 11:134865462-134865484 GCCCCACAGTTCCCCAGGAATGG - Intergenic
1091992205 12:4964422-4964444 TGCCCACACAACCCCAAGAAGGG - Intergenic
1092138457 12:6166432-6166454 TCTCCACAGGAACACAGGCATGG + Intergenic
1097176002 12:57143234-57143256 TCCCCACAGGATCCCAGCTCTGG - Intronic
1097787791 12:63780075-63780097 TCCCCGCGGGGCCTCAGGAAGGG + Exonic
1098599614 12:72315656-72315678 TGGCCACAGGAGCCCAGGACTGG + Intronic
1100607233 12:96161875-96161897 GACCCAGAGGACCACAGGAATGG - Intergenic
1102347714 12:112170154-112170176 TCCCCTCAGGAGCTCAGGGAAGG - Intronic
1103513045 12:121488425-121488447 TCACCACAGGCCCGCAAGAAAGG + Intronic
1103940270 12:124497677-124497699 TCCTGCAAGGACCCCAGGAAAGG + Intronic
1103998205 12:124843487-124843509 TTTCCACAGGACCCAAGTAATGG + Intronic
1104543279 12:129686847-129686869 TTCCCACAGGACCCCATCAATGG + Intronic
1104714671 12:131008555-131008577 TCATCACAGGAGCCCTGGAATGG - Intronic
1104924314 12:132306072-132306094 TCCCCACAGGCTCCCAGGTGAGG - Intronic
1104948761 12:132429338-132429360 TTCCCACAGGCCCCATGGAAAGG - Intergenic
1104993670 12:132641102-132641124 TCCCCACATCAGCCCAGGGACGG - Intronic
1105916619 13:24922865-24922887 TTCCCACAGGACCTCGGGACGGG - Exonic
1106409113 13:29498812-29498834 TCCCCACACGTCCCCAAGAGAGG - Intronic
1107735093 13:43391065-43391087 TCCCCACAGCTCCCCCAGAACGG + Intronic
1108508344 13:51133640-51133662 GCCCCAATGGGCCCCAGGAAAGG + Intergenic
1108996038 13:56735847-56735869 GCCGCACAGGAGCCCAGGGAGGG - Intergenic
1110251751 13:73388011-73388033 TCCCCGAAGGACCCCTTGAAGGG - Intergenic
1111561254 13:89951333-89951355 TCCCTACAAGACCCTAGGAGAGG + Intergenic
1112533130 13:100224125-100224147 GCCCCACAGGAGCCCAGGGAGGG + Intronic
1113607489 13:111620736-111620758 TTCCCACAGCCCCCCAGGAGAGG - Intronic
1114212856 14:20630787-20630809 TCGCCCCAGGAGCGCAGGAAGGG + Intergenic
1114629417 14:24149544-24149566 ACCCTGCAGGACCCCAGGCAGGG - Exonic
1115853371 14:37604503-37604525 TACTCTCAGGAGCCCAGGAAAGG - Intronic
1116452402 14:45080721-45080743 GCCGCACAGGAGCCCAGGAAGGG - Intergenic
1118390535 14:65291795-65291817 TCCTCCCAGAACCCAAGGAAGGG + Intergenic
1118734463 14:68691600-68691622 AGCCCACAGCACCCCAGGAGGGG - Intronic
1118811917 14:69281450-69281472 TCCCCAAAGCACCCCTGGATTGG + Intronic
1118817677 14:69324479-69324501 CCCTCCCAGGACCCCAGGATGGG + Intronic
1119028363 14:71171716-71171738 TCCCCAGAGCACCTCAGGGAAGG - Intergenic
1119535056 14:75396116-75396138 TCCCCAGGGAAGCCCAGGAAGGG - Intergenic
1120390269 14:83898146-83898168 TTCCCTCAGGACTCAAGGAATGG + Intergenic
1121004854 14:90483692-90483714 GCACCACAGGAACCCAGGAAAGG - Intergenic
1121714210 14:96061176-96061198 TCCTCACAGCACCTCAGGGAGGG + Intronic
1122428402 14:101624732-101624754 CCTCCACAGGACCCCATAAAGGG - Intergenic
1122827422 14:104377012-104377034 TCCCCACAGCAGCCCAGGAGAGG - Intergenic
1122842526 14:104473329-104473351 AACTCCCAGGACCCCAGGAAAGG - Intergenic
1122888551 14:104722389-104722411 GCCCCAGGGGTCCCCAGGAAGGG + Intronic
1122972089 14:105156499-105156521 TCCCCTCAGGCCCCCAAGACAGG + Intronic
1202852433 14_GL000225v1_random:30099-30121 TCCCCACGGAAGCCCGGGAACGG + Intergenic
1124230388 15:27940314-27940336 TCCCTACTGGACCCCCAGAAAGG + Intronic
1124483640 15:30098176-30098198 TCCCAACAGCACCCTAGAAATGG + Intergenic
1124519939 15:30399050-30399072 TCCCAACAGCACCCTAGAAATGG - Intergenic
1124538716 15:30567172-30567194 TCCCAACAGCACCCTAGAAATGG + Intergenic
1124759934 15:32440408-32440430 TCCCAACAGCACCCTAGAAATGG - Intergenic
1127274732 15:57432227-57432249 TAGCCACAGGGCCCCTGGAATGG + Intronic
1127772170 15:62241200-62241222 TCCCAACAGCACCCTAGTAATGG - Intergenic
1128249130 15:66152533-66152555 TACCCACAGGACCCCTGGCAAGG - Intronic
1128942836 15:71802448-71802470 TGCCCACAGGGCCCCGGGCAGGG + Intronic
1129039219 15:72671116-72671138 TCCCAACAGCACCCTAGAAATGG + Intergenic
1129210602 15:74065811-74065833 TCCCAACAGCACCCTAGAAATGG - Intergenic
1129403408 15:75299518-75299540 TCCCAACAGCACCCTAGAAATGG + Intergenic
1129727804 15:77910448-77910470 TCCCAACAGCACCCTAGAAATGG - Intergenic
1129840073 15:78738412-78738434 TCCCAACAGCACCCTAGAAATGG + Intergenic
1131669280 15:94601954-94601976 ATCCCACAGCATCCCAGGAACGG - Intergenic
1132185175 15:99797475-99797497 TCCCAACAGCACCCTAGAAATGG + Intergenic
1132216129 15:100063000-100063022 TTCCCAGACGACCCCAGCAAAGG - Intronic
1132431813 15:101767080-101767102 TCCCAACAGCACCCTAGAAATGG - Intergenic
1132511060 16:341548-341570 TCCGCACAGGAGCCCACGGAGGG - Intronic
1132615655 16:840147-840169 TCCCTCCAGGGCCCCAGGGAAGG + Intergenic
1132652311 16:1027065-1027087 TCCCCACAGGACCCACAGAGCGG + Intergenic
1133018262 16:2954911-2954933 TCTTCTCAGGACCCCAGGAAGGG - Intergenic
1133061521 16:3177858-3177880 GCTCCTCAGGACCACAGGAACGG + Intergenic
1133281960 16:4671684-4671706 TCCCCAGGGCAGCCCAGGAATGG + Intronic
1134537814 16:15040743-15040765 TCCCCCCAGCACCCCAGGCCCGG - Intronic
1136552172 16:30987634-30987656 TCCCCACAGCAGCCTGGGAAAGG - Intronic
1136558766 16:31025875-31025897 TCCACACAGGACTCAAGTAAGGG - Intergenic
1136617635 16:31408416-31408438 TCCCCACAGGAACCCAGTCCAGG + Exonic
1137385546 16:48039249-48039271 TTCCTACAGACCCCCAGGAAGGG + Intergenic
1137547083 16:49411736-49411758 TCCCCACAGGGCCCCAGCAGTGG + Intergenic
1137701934 16:50503682-50503704 ATCCCACAGGGCCCCAGGGAGGG + Intergenic
1138516774 16:57540472-57540494 TCCTCTCAGGCCCCCAGGCAGGG - Intergenic
1140457772 16:75114790-75114812 TGCCCTCAGGGTCCCAGGAAAGG + Intronic
1140655699 16:77137063-77137085 TCCCCACAGGAGCAAAGGCAAGG - Intergenic
1142635374 17:1253914-1253936 TCCCGCCGGGACTCCAGGAAGGG - Intergenic
1142931121 17:3284764-3284786 TCCTCAAAGTCCCCCAGGAAGGG + Intergenic
1142944293 17:3411743-3411765 TCCTCAAAGTCCCCCAGGAAGGG - Intergenic
1143462610 17:7113946-7113968 CTACCCCAGGACCCCAGGAAAGG - Intronic
1143912716 17:10265193-10265215 TCCCCACAGCAGCCTAGGCAAGG - Intergenic
1143925637 17:10366822-10366844 ACCCCACAGAATCACAGGAAAGG - Intronic
1144582510 17:16466900-16466922 TCCCCACAGCACCCCTAAAATGG - Intronic
1146454444 17:32998012-32998034 TGCCCACAGGCCACCAGAAATGG - Intergenic
1147266577 17:39238004-39238026 TCTCCAGAGGAGCCCGGGAATGG - Intergenic
1147585562 17:41652471-41652493 TCCCCAGAGAGCCCCTGGAATGG + Intergenic
1147835686 17:43329907-43329929 TCCCCACAGGTTAACAGGAATGG + Intergenic
1147837389 17:43344125-43344147 TCCCCACAGGTTAACAGGAATGG + Intergenic
1148085030 17:44988648-44988670 GCCCCACAGAACCCCTGGGAAGG + Intergenic
1151453922 17:74214985-74215007 TGCCCACTGAACCCCAGGAAGGG - Intronic
1151816529 17:76474027-76474049 TGCCACCAGGACCCCAGGTAGGG - Exonic
1152363370 17:79842419-79842441 TCCGCACAGGTCCCCGAGAAGGG + Intergenic
1152374542 17:79912426-79912448 TCCACCCAGAACCTCAGGAAAGG - Intergenic
1152760111 17:82103315-82103337 GCCCCCCAGGACCCCAGCAGGGG - Intronic
1153382421 18:4454721-4454743 TCCCCACGGGGACCCAGGCAGGG - Intronic
1153424140 18:4944558-4944580 CCCTCACAGGCCCCCAGGAAAGG + Intergenic
1154066516 18:11111571-11111593 TCCCTACAGGGTCCCAGGCAGGG - Intronic
1155374904 18:25146396-25146418 GCCCCAAAGGACACCTGGAAGGG - Intronic
1155566118 18:27136271-27136293 GCTTCACAGGAACCCAGGAAAGG + Intronic
1156918693 18:42492140-42492162 TCCACAATGGACACCAGGAATGG + Intergenic
1158721723 18:59931201-59931223 GCTCCACAGGCCCCCAGCAAGGG + Intergenic
1160032980 18:75278567-75278589 CCCCCACAGGCCCCCAACAAGGG - Intronic
1160993598 19:1871800-1871822 TCCCTGCAGGACCCCACGCAGGG - Intergenic
1161160333 19:2758028-2758050 CCCCCAGAGGACCCCTGCAATGG + Intronic
1161371346 19:3913647-3913669 TCCCCACAGGACCCCACTCCAGG - Intronic
1161468548 19:4445304-4445326 TCCCCACAGCCCCCAAGGGATGG + Exonic
1161885954 19:6995813-6995835 TCCCCACAGGAACACAGTAGTGG + Intergenic
1161959728 19:7516683-7516705 TTCCCCCAGGACCCTAGGAAGGG + Intronic
1162757012 19:12866575-12866597 TCCCCACAGGAGCCCAGTCCTGG - Intronic
1163002794 19:14379225-14379247 CCCCCACAGGAGCCCAGGACAGG + Intergenic
1163025733 19:14510732-14510754 TCCCCGCAGCATCTCAGGAAAGG + Intergenic
1163063955 19:14779514-14779536 CCCCCACAGGAGCCCGGGACAGG - Intergenic
1164632030 19:29768272-29768294 TCACCAGGGGACCTCAGGAAAGG - Intergenic
1165447768 19:35866148-35866170 TCCCCTCAGGACCCAACCAACGG + Exonic
1165992645 19:39825418-39825440 TCACCCCAGGACCCTAGGAGGGG - Exonic
1166175306 19:41064401-41064423 TCCAGACAGGAAGCCAGGAATGG + Intergenic
1166443724 19:42839831-42839853 TTCCTACAGGCTCCCAGGAAGGG + Intronic
1166451171 19:42902513-42902535 TTCCCACAGGCTCCCAGCAAGGG + Intronic
1166463417 19:43010494-43010516 TTCCTACAGGCTCCCAGGAAGGG + Intronic
1166480695 19:43170593-43170615 TTCCCACAGGCTCCCAGGAAGGG + Intronic
1166490280 19:43253713-43253735 TTCCTACAGGCTCCCAGGAAGGG + Intronic
1166669524 19:44701526-44701548 CCCCCCGAGGACCCCAGGGAGGG + Intronic
1167774735 19:51547412-51547434 TCCCCCCAGGACACCTGGGAGGG + Intergenic
1168104173 19:54156567-54156589 ACACCACAGCACCCCGGGAAAGG + Intronic
1168251663 19:55145661-55145683 GGCCCCCAGGACCCCAGGGAAGG + Intronic
925308271 2:2865273-2865295 TCCCCACACCACCCCAGACAGGG - Intergenic
927050996 2:19329046-19329068 TCACCAGAGTACCCAAGGAAAGG + Intergenic
927315671 2:21678142-21678164 TCCCCAGAAAACCCCAGGGAAGG + Intergenic
927329432 2:21844607-21844629 GCCACTCAAGACCCCAGGAAAGG + Intergenic
928381737 2:30823940-30823962 GCCCCACAGGTCCCAAGGCAAGG - Intergenic
931235673 2:60410703-60410725 CAGCCACAGGACCCCAGGAGGGG + Intergenic
933897446 2:86824573-86824595 TCCCCACAGGACCCCAGGAAGGG - Intronic
934665055 2:96164014-96164036 CCCCTACAGCAACCCAGGAAAGG - Intergenic
935595384 2:104873666-104873688 GCCCGACAGGAGCCCAGGATGGG + Intergenic
935655827 2:105421985-105422007 ACGCAACAGGACCCCAGGAGGGG - Intronic
936644301 2:114350812-114350834 GCCCCAAAGAACCCCAGGGAAGG - Intergenic
938210047 2:129459565-129459587 TCCCTCCAGGTCCCCAGGGAAGG - Intergenic
938700680 2:133876361-133876383 TCCTCATGGAACCCCAGGAATGG - Intergenic
939141096 2:138355466-138355488 TCACCACACAGCCCCAGGAAAGG + Intergenic
940581281 2:155584125-155584147 TTCTCACATGCCCCCAGGAAAGG + Intergenic
941712082 2:168724973-168724995 TCCCCACAGGAGCCCACGGAGGG + Intronic
947468762 2:230381027-230381049 TCCCCTCAAGACCCAAGAAAAGG + Intronic
947663797 2:231890240-231890262 TCCCCACAAGCCCCCATGAAGGG - Intergenic
948454077 2:238096721-238096743 GCCCAGCAGGACCCCGGGAAGGG + Intronic
948608813 2:239154158-239154180 TCCACCAAGGGCCCCAGGAAAGG - Intronic
948858943 2:240743601-240743623 CCCACCGAGGACCCCAGGAAAGG - Intronic
1169197685 20:3692325-3692347 TGCCCACAGGACTCCTGGGAAGG - Intronic
1169493672 20:6092617-6092639 TCCACACAGAACCCCATGCAAGG + Intronic
1171210513 20:23313049-23313071 TGCCCACAGGAGGCCAGGCAAGG + Intergenic
1171227511 20:23453513-23453535 TCCCATCAGGTCCCCAGGATGGG - Intergenic
1171522479 20:25786425-25786447 TCCCTGCAGGCCCCCAGGACAGG - Intronic
1171554348 20:26069458-26069480 TCCCTGCAGGCCCCCAGGACAGG + Intergenic
1172892823 20:38279019-38279041 ATACCACAGGAGCCCAGGAAGGG + Intronic
1173332662 20:42088089-42088111 TCCCCTCTGTACCCCAGCAATGG - Intronic
1173338883 20:42136546-42136568 TCCTCCCAGGACCCCACAAAGGG - Intronic
1173586467 20:44186811-44186833 TCACCACTGCACCCCAGGAGGGG + Exonic
1175397901 20:58679957-58679979 TCCTCGGAGGACCCCAGGACAGG - Intronic
1176163626 20:63661515-63661537 TCCCCACAGGAGGCCAGGAGAGG - Intronic
1176254901 20:64146748-64146770 TCCCCTCAAGACCCCAGGCCTGG + Intergenic
1179173591 21:38991624-38991646 TGCGCCCAGGACCCCAGGGATGG - Intergenic
1179397298 21:41053008-41053030 TCCCCACTGCACCCCTGGATGGG + Intergenic
1179655321 21:42841360-42841382 TCCCCCCAGGACCTTGGGAATGG - Intergenic
1179712147 21:43269458-43269480 TCCCCAGAGGAAACCACGAAGGG + Intergenic
1179921858 21:44511938-44511960 TGCCCAAAGGAGCCCTGGAACGG + Intronic
1180967945 22:19800286-19800308 TGTGCCCAGGACCCCAGGAAGGG - Intronic
1181273128 22:21672484-21672506 TCCTCACTGGGCCCCATGAACGG - Intronic
1181490128 22:23256383-23256405 TTCCCACAGCACCCCGGGCAAGG - Intronic
1182666913 22:31966809-31966831 TCCCCACAGGAGCTCTGGGAGGG + Intergenic
1183365051 22:37402581-37402603 TGCCCACAGTTCCCAAGGAAGGG + Intronic
1183608919 22:38884145-38884167 CCCCCTCAAGACCCCAGGGAAGG - Intergenic
1184105067 22:42362668-42362690 TCCCCACACAAACCCATGAAAGG - Intergenic
1184175640 22:42787336-42787358 TCCCAACAGCACCCTAGTAATGG + Intergenic
1184616947 22:45644927-45644949 TCCCCACCAGACGCCAGGAGTGG + Intergenic
951140038 3:19148223-19148245 TCTCCACGGGACGCCGGGAAAGG - Intergenic
953032256 3:39186504-39186526 CCCCCACTGGACCCCAGCATGGG - Exonic
953167884 3:40481739-40481761 GCCACACAGGACCCCAGCAGGGG - Intronic
954301313 3:49702163-49702185 TCCCCACAGGGCCCCACCCAGGG - Intronic
954409290 3:50363385-50363407 TCCCCACTGGCCCCCAGGCTGGG + Intronic
954610290 3:51941568-51941590 TTCCCTCAGAACCCCAGGAATGG + Intronic
955046969 3:55369766-55369788 TCTCCACAGGAACCCAGGACCGG - Intergenic
955492855 3:59500422-59500444 ACCCCACAGGCCCACAGGAATGG + Intergenic
956742599 3:72286840-72286862 TCCCCACAGAATCTCAGGGAAGG - Intergenic
958838147 3:99171210-99171232 CCCCCACACTTCCCCAGGAAAGG + Intergenic
959759565 3:109944050-109944072 TACCAACAGGAAACCAGGAAGGG - Intergenic
964549111 3:157867184-157867206 TGCCCAGAAGATCCCAGGAAAGG + Intergenic
964922315 3:161912252-161912274 TTGCTACAGGACCCCAGGCAAGG + Intergenic
968470744 4:781324-781346 CCCACACACGACCCCAGGCAAGG - Intergenic
968526363 4:1059615-1059637 TCCCCAGAGACCCCCAGGGAGGG - Intronic
970332502 4:15001856-15001878 TCACCACAGGACCCCCGGGCTGG + Intergenic
972202438 4:36730395-36730417 GAGCCACAGGAGCCCAGGAAGGG + Intergenic
977002356 4:91519489-91519511 TCCCTATAGGCCCCGAGGAAGGG - Intronic
982281108 4:153684400-153684422 GCCCGACCCGACCCCAGGAAGGG - Intergenic
986216203 5:5721469-5721491 GCCCCACCAGACCTCAGGAATGG + Intergenic
987081710 5:14431177-14431199 GCCACACAGAACCCCAGAAAGGG - Intronic
992612645 5:78520578-78520600 ACCCCACAGGTTACCAGGAATGG + Intronic
993005494 5:82424498-82424520 TCCCCACACGACCCCAGCTTTGG - Intergenic
997677549 5:135724546-135724568 ACCCCACAGGAACCCTGGACAGG + Intergenic
998712541 5:144843242-144843264 TCCCCTCAGCACCCCTTGAAGGG + Intergenic
1001211380 5:169813056-169813078 TCCCCGCAGGAGCCCCTGAAAGG - Intronic
1001299106 5:170520964-170520986 GCCCCACAGCAACCCAAGAAGGG - Intronic
1002419487 5:179138181-179138203 TCCCCACAGGAACCCCAGGAGGG - Intronic
1002836762 6:871165-871187 TCCCCACAGGGCCCCACAAGGGG + Intergenic
1004667076 6:17758020-17758042 CCCCCAAAGGCCCCCAGGAAGGG + Intergenic
1005389696 6:25320750-25320772 TTTCCAAAGGATCCCAGGAATGG + Intronic
1005939960 6:30553349-30553371 ACCCCACAGGACCCTAGTAGTGG - Exonic
1006069376 6:31487050-31487072 GCCCCACAGGCACCCAGGATAGG - Intergenic
1006174205 6:32112128-32112150 TCCCCAAACAACTCCAGGAAAGG + Intronic
1006625248 6:35393055-35393077 TCCTCATAGGCCTCCAGGAAGGG + Intronic
1006931569 6:37692137-37692159 GGCCCACAGGAGCCCAGGAAAGG + Intronic
1011431984 6:87297133-87297155 TGGCCACAGGACCCAACGAAGGG + Intronic
1013457307 6:110342277-110342299 TCCCAACAGCTCCCCAGGCATGG - Intronic
1014203303 6:118627712-118627734 TCCCCTCATGACTCCAGAAAAGG + Intronic
1014402343 6:121006193-121006215 TCTTCACAGGACAGCAGGAAAGG - Intergenic
1015754149 6:136590870-136590892 TCACCAGAGTACCCCAGGTAAGG - Intronic
1017023280 6:150159059-150159081 TACCCACAGGACGGAAGGAAAGG + Intronic
1018064195 6:160114576-160114598 GCCGCACAGGAGCCCAGGGAGGG + Intergenic
1018201959 6:161403437-161403459 TCTCCACAGGACAACAGTAAAGG - Intronic
1018702105 6:166435584-166435606 TCCCCACAGGACCTCAGCCTGGG - Intronic
1018907749 6:168085215-168085237 TCCCCACAGGCCCTCAGGTTGGG - Intergenic
1019075957 6:169388286-169388308 TCCCATCAGGATCACAGGAATGG - Intergenic
1020151531 7:5685386-5685408 TCCCCACAGAAGCCCTGGGATGG + Intronic
1020763489 7:12294315-12294337 TCCCCCCTGGAACCCAAGAATGG + Intergenic
1022015499 7:26345496-26345518 ACCCCACAGGGCCTCTGGAAGGG - Intronic
1022703749 7:32784539-32784561 TCCTCTGAGGACCCTAGGAATGG + Intergenic
1022907990 7:34874665-34874687 TCCTCTGAGGACCCTAGGAATGG + Intronic
1023110781 7:36808608-36808630 TGCCCACAGGCCCCTAAGAAGGG + Intergenic
1023120283 7:36902079-36902101 ACCCCACAGGACCCTAGACAAGG - Intronic
1023207833 7:37770209-37770231 TCCCCACAGTCCATCAGGAAGGG + Intronic
1025199097 7:56950774-56950796 CCCCCACAGGGACCCAGGACAGG - Intergenic
1025672850 7:63626159-63626181 CCCCCACAGGGACCCAGGACAGG + Intergenic
1026962449 7:74417445-74417467 TCACCCCAGGACCCCACAAAAGG - Intergenic
1029155062 7:98511371-98511393 TCTGCACACCACCCCAGGAAAGG - Intergenic
1032079077 7:128849730-128849752 TCCCCACAGCACCCCCGAAGTGG + Intronic
1034956895 7:155340389-155340411 GAACCACAGGACCCCAGGGATGG + Intergenic
1035250663 7:157594841-157594863 GCCCTACAGGACTCCAGGAGAGG + Intronic
1035595322 8:853293-853315 TCCCCACAGAGTCCCAGGAGGGG + Intergenic
1035604390 8:920122-920144 TCCCCACAGAGTCCCAGGAGGGG + Intergenic
1035779378 8:2216039-2216061 ACCCCAGAGGACCCAGGGAAAGG + Intergenic
1036207496 8:6815817-6815839 TCCAGACAGGACCCCAGCTATGG + Exonic
1037670690 8:21012884-21012906 TCCCAACAGGACTCCAGTCAAGG - Intergenic
1037793353 8:21967905-21967927 TCCCCCCAGGGTCCCATGAAAGG + Intronic
1040541419 8:48360357-48360379 TCCTCACAGGACCCCGTGAGAGG - Intergenic
1040605185 8:48924414-48924436 TCCCCACAGGCTCCCTGGATGGG + Intergenic
1045474887 8:102544301-102544323 TCCCCGCAGGAGCCCAGCAGGGG - Intergenic
1049154861 8:141060269-141060291 TCCACTCAGGACCCCAGAATGGG - Intergenic
1049237533 8:141519523-141519545 TCCCCACAGAACACCAAGCAGGG + Intergenic
1049243090 8:141548618-141548640 TCCCCACAGGGCTTCAGGGAGGG + Intergenic
1049266922 8:141672577-141672599 GCCCAGCACGACCCCAGGAAGGG + Intergenic
1050878991 9:10675627-10675649 CCCTCACATGCCCCCAGGAAAGG - Intergenic
1054825978 9:69573773-69573795 TTTCCACAGGACCCCAGCAGAGG - Intronic
1056713343 9:89009207-89009229 TCCACACAGGATCACAGGGAAGG - Intergenic
1056743789 9:89282710-89282732 GCCCCACAGGAGCCCATGGAGGG - Intergenic
1057786695 9:98093404-98093426 TCCTCACAGCAGCCCAGGAGAGG + Intronic
1057969975 9:99545410-99545432 TCCCCACCCTACCCCAAGAAGGG - Intergenic
1061041814 9:128144956-128144978 AGCCCCCAGCACCCCAGGAAAGG - Intergenic
1061062636 9:128258324-128258346 TCACCACTGGCTCCCAGGAAAGG + Intronic
1061626083 9:131841516-131841538 GCCCAGCAGGACCCCAGGCATGG - Intergenic
1062191388 9:135249605-135249627 TCTCCCCAGGGCCCCAAGAATGG - Intergenic
1062343098 9:136102464-136102486 CCCTCACTGGACCCCAGGGAGGG - Intergenic
1062363421 9:136198009-136198031 GCCCCACAGCAGCCTAGGAAGGG + Intronic
1062441485 9:136571632-136571654 ACCCCACAGGACAGCAGGGAAGG - Intergenic
1187173228 X:16870897-16870919 GCCCGACCGGGCCCCAGGAAAGG - Intergenic
1187858631 X:23660825-23660847 TCCCCACAGGATCCCACAAAAGG + Intergenic
1193317259 X:80077857-80077879 CCCTCACATGCCCCCAGGAAAGG - Intergenic
1193422955 X:81306644-81306666 TACCCACAGGTCCACAGTAAAGG - Intergenic
1196234412 X:113261943-113261965 CCCTCACATGTCCCCAGGAAAGG - Intergenic
1199780289 X:151052106-151052128 TGCCCACAGGGCCCCTGGGAAGG + Intergenic
1201567556 Y:15382948-15382970 TCCCCCCAAGACCCCAGTGAAGG + Intergenic
1202137060 Y:21676739-21676761 GCCGCACAGGAGCCCAGGGAGGG + Intergenic