ID: 933899537

View in Genome Browser
Species Human (GRCh38)
Location 2:86839760-86839782
Sequence CAGTGGGACAAGAGGCCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 1, 2: 1, 3: 27, 4: 215}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933899537 Original CRISPR CAGTGGGACAAGAGGCCTTG TGG Intronic
902635557 1:17732928-17732950 CAGAGGGACCTGAGGCCATGAGG + Intergenic
902919492 1:19657619-19657641 AAGTGGGGTGAGAGGCCTTGGGG - Exonic
903561782 1:24233508-24233530 CAGTGGCCAAAGAGGCCTTGGGG + Intergenic
904373728 1:30066542-30066564 CTGGGGGACAGGAGGCCTTGGGG - Intergenic
904399535 1:30247140-30247162 CAGTGAGACATGTGCCCTTGTGG - Intergenic
907002302 1:50873732-50873754 CAGTGTGCCGAGAGCCCTTGTGG - Intronic
907315972 1:53572830-53572852 CCCTGAGACAGGAGGCCTTGGGG - Intronic
912552539 1:110493486-110493508 CAGTGAGCCCAGAGGCCATGAGG - Intergenic
913346906 1:117818509-117818531 CAGAGTTACAAGAAGCCTTGGGG - Intergenic
913551607 1:119922241-119922263 CAGTGGGACAGGATGCTGTGGGG - Exonic
913960931 1:143337722-143337744 CAGAGGCACAGGAGGCCATGGGG + Intergenic
914055284 1:144163294-144163316 CAGAGGCACAGGAGGCCATGGGG + Intergenic
914123861 1:144803067-144803089 CAGAGGCACAGGAGGCCATGGGG - Intergenic
914317571 1:146528605-146528627 CAGAAGGACAAGAGCTCTTGAGG - Intergenic
914496784 1:148204755-148204777 CAGAAGGACAAGAGCTCTTGAGG + Intergenic
915125105 1:153658552-153658574 CCGTAGGAGTAGAGGCCTTGTGG - Intergenic
915253460 1:154607626-154607648 CAGTGCGTGAAGAGGGCTTGGGG - Intronic
916001193 1:160617700-160617722 AAGTGGCACAGGAGGCCTTCAGG + Intronic
916472282 1:165136143-165136165 CAGAGGGAAGACAGGCCTTGAGG + Intergenic
916691259 1:167192265-167192287 CAGTGGGACAGGATGACTTCTGG - Intergenic
917351754 1:174085240-174085262 CAGGGGAACAAGAGGCACTGGGG - Intergenic
1062794822 10:336762-336784 CAGTGGGACAAGAGGTGGAGGGG + Intronic
1062923686 10:1298653-1298675 CAGTGGGGCACGTGCCCTTGAGG - Intronic
1069042736 10:63711840-63711862 CAGTGGGACCGAATGCCTTGAGG + Intergenic
1069610010 10:69766648-69766670 CAGTGGGAGCAGAAGCCATGGGG - Intergenic
1070607598 10:77909911-77909933 CCCTGGGACAAGAGGCCCGGTGG + Intronic
1070653190 10:78252800-78252822 CATTGGGATAAGAGGAATTGTGG + Intergenic
1071500825 10:86203265-86203287 CAGTGGGAGGAGGGGCCCTGAGG + Intronic
1074857400 10:117483574-117483596 CAGAGGGACAGGAGGGCCTGAGG + Intergenic
1076596460 10:131625604-131625626 CTGTTGGAGATGAGGCCTTGGGG - Intergenic
1077333192 11:1992388-1992410 CAGTTAGAGAAGAGGACTTGAGG - Intergenic
1078536637 11:12180114-12180136 CAGGGCCACTAGAGGCCTTGGGG + Intronic
1078765840 11:14297176-14297198 CAGTGGGAAAATGGGCTTTGAGG - Intronic
1079050589 11:17154590-17154612 GAGTGGAACAACAGTCCTTGTGG - Intronic
1081572448 11:44300238-44300260 CAGTGGTTTCAGAGGCCTTGGGG - Intronic
1081813509 11:45926350-45926372 GAGTGGGACAAGAGGCTGTGTGG + Intronic
1081992496 11:47345371-47345393 CAGAGGGATAAGGGGCCTGGGGG + Intronic
1082756297 11:57079874-57079896 CAGTGTGAAAAGAGGCCCAGAGG - Intergenic
1084035989 11:66510721-66510743 GGGTGGGAAAAGAGGCCTTGAGG - Intronic
1084979281 11:72820767-72820789 CAGTGTGACAAGAGAACATGAGG - Intronic
1085297033 11:75437149-75437171 CAGTGGGACAAGAGTCCTGCTGG - Intronic
1088732935 11:112699335-112699357 TAGGGGGACCAGAGGACTTGGGG + Intergenic
1089528515 11:119112305-119112327 CTGTGGGACAAGAGGAGATGGGG - Intronic
1090503518 11:127285088-127285110 AAGTGGAACTAGAGGCTTTGTGG + Intergenic
1091315495 11:134611253-134611275 AGGTGGGACATGAGGCCTTCTGG + Intergenic
1202816172 11_KI270721v1_random:47569-47591 CAGTTAGAGAAGAGGACTTGAGG - Intergenic
1094492010 12:30966657-30966679 CAGAGGGACCAGAGGCCAAGGGG + Intronic
1097422991 12:59403824-59403846 CAGTCAGAGAAGAGGTCTTGAGG - Intergenic
1100532667 12:95474509-95474531 CTGTGGGACTAGAGGGCTGGTGG + Intronic
1106012300 13:25836575-25836597 CAGTGGGGCAACAGGCATAGAGG - Intronic
1107430063 13:40332468-40332490 CAGAAGTACCAGAGGCCTTGGGG + Intergenic
1109696146 13:65961562-65961584 CATTGAGACAAAAGGCCTTCAGG + Intergenic
1110310010 13:74037954-74037976 CAGTAGCACAGGAAGCCTTGTGG + Intronic
1110616180 13:77544592-77544614 CATTGGGACAAGAGGAGCTGGGG + Intronic
1110929136 13:81193892-81193914 CAGTGGGACTACAGGCATTGGGG + Intergenic
1112684092 13:101802910-101802932 CTGTGGGAGAAGAGGCCTTTTGG + Intronic
1114999233 14:28401415-28401437 CAGTTGGACATGAGCCCTAGTGG - Intergenic
1115461492 14:33666005-33666027 CAGTGAGACAATTGTCCTTGTGG + Intronic
1115647996 14:35383694-35383716 CAGTGGGACAAGATGGCTGGTGG + Intergenic
1118236845 14:64013501-64013523 GAGTGGAATAATAGGCCTTGGGG - Intronic
1119099722 14:71868768-71868790 CAGTAGGACGAGAGGCCAAGGGG - Intergenic
1122891543 14:104734361-104734383 CACTGGCACAAGAGGCCCTTGGG + Intronic
1123695298 15:22874574-22874596 CAGTGGGACAAGATGCAGCGGGG + Exonic
1124879699 15:33630595-33630617 CTGTGGGACAAGGGACCTTACGG - Intronic
1125918838 15:43512352-43512374 CCCTGGGAGAAGTGGCCTTGCGG + Intronic
1126568655 15:50126897-50126919 CACTGGCACAACAGACCTTGGGG + Intronic
1127478699 15:59358414-59358436 AGGATGGACAAGAGGCCTTGTGG + Intronic
1129237123 15:74230301-74230323 CAGAGGGCAGAGAGGCCTTGGGG - Intergenic
1129414026 15:75364800-75364822 CAGTGTGACAAGAGTGCATGTGG + Intronic
1129579489 15:76792221-76792243 CAATGGGAGAAGAGGGCTGGAGG - Intronic
1129715233 15:77844239-77844261 CTGTTGGAGAAGAGGCCTGGTGG + Intergenic
1130783367 15:87069130-87069152 CAGTTGTATCAGAGGCCTTGAGG + Intergenic
1131083999 15:89560132-89560154 CAGTGGCAGAGGAGGCCTGGTGG + Intergenic
1131643278 15:94314994-94315016 CAGTTGGACATGTGGGCTTGTGG + Intronic
1132506900 16:314837-314859 CAGAGGGACAAGAGGACAGGTGG - Intronic
1133055335 16:3142969-3142991 CAGGGGGACAAGAGTCCCAGGGG - Intergenic
1135424835 16:22327247-22327269 AACTAGGACAGGAGGCCTTGTGG + Intronic
1136598193 16:31266023-31266045 CGGTGGGACCACAGGCCTAGGGG - Exonic
1141043296 16:80690801-80690823 CAGAGGGAGAGGAGGCCCTGTGG - Intronic
1141105332 16:81228850-81228872 CTGTGGGACAAGTGGCCTCAGGG + Intergenic
1141325421 16:83052983-83053005 CAGTGAGACCATAAGCCTTGTGG + Intronic
1141834856 16:86532003-86532025 CAGAGGGACAAGTGACCTCGTGG - Exonic
1142813480 17:2407649-2407671 CAGTGGGCCCTGGGGCCTTGGGG - Intronic
1143593133 17:7897948-7897970 CTGTGGGGCAGGAGGCCATGGGG - Intronic
1144511102 17:15877560-15877582 CAGTCAGAGAAGAGGCCTGGGGG + Intergenic
1144713571 17:17419283-17419305 CAGTGGGATTTGAAGCCTTGTGG + Intergenic
1145175262 17:20695247-20695269 CAGTCAGAGAAGAGGCCTGGGGG + Intergenic
1145894646 17:28447390-28447412 CAGTGTGAAAAGTGGCCATGGGG + Intergenic
1148562973 17:48616727-48616749 CAGTGGCTCAAAAGGTCTTGGGG - Intronic
1149208994 17:54281980-54282002 AAGTGGGTCAAAAGGCCTTCAGG + Intergenic
1149579178 17:57736519-57736541 CCATGGGCCAACAGGCCTTGGGG - Intergenic
1151727222 17:75892144-75892166 CAGTGGCCCAAGAGGCCCTGGGG + Exonic
1151727504 17:75893284-75893306 CAGTGGCCCAGGAGGCCCTGGGG + Intronic
1152024313 17:77798808-77798830 CAATGGGACATGAGGCATTGGGG + Intergenic
1152238998 17:79151985-79152007 CTGCGGGACAGGGGGCCTTGGGG - Intronic
1152693735 17:81733722-81733744 CAGAGGAAGAACAGGCCTTGTGG - Intergenic
1153319667 18:3760212-3760234 CATTGTGACAAGAGGCCCAGTGG + Intronic
1153953424 18:10076217-10076239 CATGGGGACAGGAGGCCATGAGG - Intergenic
1157444953 18:47737722-47737744 AAGTGGCCCCAGAGGCCTTGTGG + Intergenic
1157624705 18:49041738-49041760 CAGTGAGCCCAGAGGCCTGGAGG + Exonic
1157853927 18:51085941-51085963 CAGATGGACAAGAGGCGTTCAGG + Intergenic
1157921019 18:51712641-51712663 GAGTGGGAAAAGAGGATTTGGGG - Intergenic
1157922266 18:51725535-51725557 CAGTGGGAGTAGAGGCCGTGAGG + Intergenic
1158512056 18:58099309-58099331 GAGTAAGACAACAGGCCTTGAGG - Intronic
1159138942 18:64369459-64369481 CAGTTGGACATGAGCCCTAGTGG - Intergenic
1166293342 19:41877293-41877315 CACTGGGAGAAGATGCCTGGGGG + Exonic
1167312912 19:48747367-48747389 CAGTGGGAGGAGAGGACTGGGGG + Intergenic
1167553648 19:50178706-50178728 AAGAGGGACAAGAGGGCTTGGGG + Intergenic
1167698065 19:51026463-51026485 GAGTGGGACAGGTGTCCTTGGGG + Intronic
1168258919 19:55181959-55181981 CAGTGGGACGAGGGACCCTGGGG - Intronic
1168325842 19:55537849-55537871 AACTGGGAAGAGAGGCCTTGAGG - Intergenic
1202694767 1_KI270712v1_random:115971-115993 CAGAGGCACAGGAGGCCATGGGG + Intergenic
926039812 2:9664100-9664122 CAGTGGGGCAAGAGGAATTCAGG - Intergenic
929410882 2:41696524-41696546 TAGAGGGAAAAGAGGCCTTCAGG - Intergenic
930608035 2:53512214-53512236 CATTTGGACAAAAAGCCTTGTGG + Intergenic
931400236 2:61924939-61924961 CAGAGGAACCAGAGGCCTGGAGG + Intronic
932284994 2:70524633-70524655 CACTGTGACACGAGGCCTTGAGG + Intronic
932822912 2:74916526-74916548 CAGTGGGTGCAAAGGCCTTGAGG + Intergenic
933005020 2:76981371-76981393 CAGTTGGAATAGATGCCTTGAGG - Intronic
933899537 2:86839760-86839782 CAGTGGGACAAGAGGCCTTGTGG + Intronic
934275939 2:91573020-91573042 CAGAGGCACAGGAGGCCATGGGG + Intergenic
935781021 2:106509466-106509488 CAGTGGGACAAGGGGCCTTGTGG - Intergenic
938263327 2:129910249-129910271 CAGTGGCACAGGTGGGCTTGGGG - Intergenic
939290005 2:140181966-140181988 AAGTGGGACTAGAGGCATTGAGG + Intergenic
941654000 2:168123990-168124012 CAGTGGGGCCAAGGGCCTTGGGG + Intronic
942306654 2:174614462-174614484 CAGAGAGAAAATAGGCCTTGAGG + Intronic
942471482 2:176265301-176265323 CAATTGGAGAAGAGGCCTGGTGG + Intergenic
943630692 2:190248555-190248577 CAGTTGTACAAGAAGACTTGTGG + Intronic
946279419 2:218656103-218656125 CAGTGGGACAAGCAGCTCTGAGG - Intronic
947723001 2:232380600-232380622 CTGTGGGACAAGGGGTCCTGTGG - Intronic
947727351 2:232408681-232408703 CTGTGGGACAAGGGGTCCTGTGG - Intronic
948054946 2:235003967-235003989 CAGTGGGACTGCAGGCTTTGGGG + Intronic
948863318 2:240763355-240763377 CAGAGGGACAGGTGGCCTTGAGG + Intronic
1168888554 20:1277316-1277338 CCTTGGGACTAGAGGCCATGTGG + Intronic
1170877683 20:20266071-20266093 CAGTGTGAGAGGAGGCCTCGAGG + Intronic
1170907310 20:20527988-20528010 GAGTGGGACATGAGGCTTGGGGG + Intronic
1172011985 20:31850903-31850925 CATTGGGAGAAGAGGCTGTGAGG + Intronic
1172485760 20:35297008-35297030 CAGTGGCACAATAGCCCATGGGG - Intergenic
1172834353 20:37863538-37863560 CAGAGGGAGCAGAGGCCTGGAGG + Intronic
1174686600 20:52461949-52461971 AAGTGGGAGAAGAAGCCCTGTGG - Intergenic
1175391126 20:58628077-58628099 CAGTGGGGCAAAGGGCCTTGGGG + Intergenic
1175785471 20:61709096-61709118 CACTGGGACCCGAGGCTTTGGGG - Intronic
1175891078 20:62316243-62316265 CAGTGGGACCAGAGGCCTTCAGG - Intronic
1175912662 20:62412206-62412228 CAGGTGGACAAGGGGCCCTGGGG + Intronic
1176413140 21:6459500-6459522 CTGTGGGTGCAGAGGCCTTGGGG - Intergenic
1177278173 21:18943166-18943188 CAGTAAGACAAGGGGCCCTGAGG + Intergenic
1177760410 21:25396449-25396471 CAGTGTGACTAGAGGCCTGCTGG + Intergenic
1178462775 21:32818168-32818190 CAGTGGAATTTGAGGCCTTGTGG - Intergenic
1179078980 21:38152488-38152510 CAGTGGGAGAACAAGCCATGGGG + Intronic
1179688636 21:43067822-43067844 CTGTGGGTGCAGAGGCCTTGGGG - Intronic
1180903040 22:19388412-19388434 CATTGGAACATGAGGCCTTCTGG - Intronic
1181165570 22:20981216-20981238 CAGTGGCAGCAGAGGCCTTGAGG - Exonic
1181496081 22:23288340-23288362 CAGGGGAACAAGAGGGCTGGGGG - Intronic
1182144674 22:27990203-27990225 CATTGGGGCAAGAGGCTGTGTGG + Intronic
1182342269 22:29632964-29632986 CCCTGGGAAAAGAGGTCTTGGGG - Intronic
1182414264 22:30210765-30210787 CAGTGGGACCAGAGCCCTGGTGG + Intergenic
1183358202 22:37370521-37370543 CACCGGGACAAGAGCCCTTGAGG + Exonic
950457027 3:13099017-13099039 CATTGGGATAAGAGGACTTTCGG + Intergenic
950647539 3:14386287-14386309 CATGGGGACCAGAGGCCATGTGG - Intergenic
952809284 3:37387063-37387085 CAGTGGGCCAAGGGGCCTGGGGG - Intronic
954445590 3:50545139-50545161 GATGGGGCCAAGAGGCCTTGGGG - Intergenic
954856906 3:53651979-53652001 CAGTGGGACAATTAGACTTGTGG + Intronic
955389878 3:58513984-58514006 CAGTGGGAAAAAAGGTCTGGGGG + Intronic
956126384 3:66014845-66014867 CAGTGGGAGCAAAGGCCTGGAGG - Intronic
956888565 3:73586333-73586355 CAGTATGTCATGAGGCCTTGGGG - Intronic
958839613 3:99187328-99187350 CAGTGACACAAGTAGCCTTGTGG - Intergenic
959457164 3:106576881-106576903 CTGTGGGAAAAGAGGCATTAGGG - Intergenic
959980819 3:112514920-112514942 CTGAGTGACCAGAGGCCTTGTGG - Intergenic
961812815 3:129531538-129531560 CAGAGGGACATGAGGCCTCTGGG - Intronic
963041210 3:141071371-141071393 GACAGAGACAAGAGGCCTTGGGG + Intronic
963797644 3:149647189-149647211 GAGGGGGACAAGAGGACTGGAGG + Intronic
964154089 3:153564063-153564085 CATTGGGAAAAAATGCCTTGAGG + Intergenic
966200867 3:177358896-177358918 CACTGGGGCCAGAGGCCCTGTGG - Intergenic
966740841 3:183231938-183231960 CAGTGGGGCCAGAAGTCTTGGGG - Intronic
967912255 3:194552151-194552173 CTATGGGAGAAGAGGCATTGGGG - Intergenic
968687201 4:1969153-1969175 CAGTGGGAAAAGAAGGCATGGGG + Intronic
970725318 4:19037018-19037040 AAGGAGGACAAGAGGCATTGAGG - Intergenic
970906676 4:21224433-21224455 CATTGGGAGATGAGGCTTTGGGG - Intronic
971296129 4:25394051-25394073 CAATGGGAAAAGAGCCCTTTTGG - Intronic
972686663 4:41359665-41359687 GAGTGGGACAAGAGGAGATGAGG + Intronic
974158130 4:58101288-58101310 TAGTGGGAAAAGATGCCTTATGG - Intergenic
975346567 4:73299250-73299272 CAGTTGGCCAAAAGGCATTGAGG - Intergenic
979615336 4:122735898-122735920 CAGAGGGAAAAGAGGATTTGTGG + Intronic
982591232 4:157314500-157314522 CATTTGAACAAGAGGCCTTCAGG - Intronic
984656974 4:182328890-182328912 CAGTGGGGAATCAGGCCTTGTGG - Intronic
986466612 5:8032553-8032575 TGGTGGAACAAGAGGCCATGGGG - Intergenic
986939872 5:12937054-12937076 CAGAGGTACAAGAGGTCTTGGGG + Intergenic
988102860 5:26704736-26704758 CAGTGGGACAAGAGGGAGAGGGG + Intergenic
990131133 5:52585766-52585788 CAGTGGGTAGAGAGGTCTTGTGG + Intergenic
990626922 5:57623991-57624013 CAGTGGGGGCAGAGGCCATGAGG + Intergenic
991597318 5:68318931-68318953 AAGGGGTACAGGAGGCCTTGAGG + Intergenic
992547836 5:77832483-77832505 CAGTGGGACTAGAGGCGAGGAGG - Intronic
993668348 5:90728857-90728879 CAGTGGGACAACAGAAGTTGAGG + Exonic
996770426 5:127080001-127080023 TGGTGGGAGTAGAGGCCTTGAGG + Intergenic
997248168 5:132369537-132369559 CAGCGGGACTCGAGGCCTTGGGG - Intergenic
1001100956 5:168813959-168813981 CAGGAGGAAAAGAGGCATTGGGG - Intronic
1001960455 5:175877501-175877523 GTGTGGGACAAAAGGCCTTGGGG + Intronic
1002176559 5:177404269-177404291 GAGTGGGACATGAAGCCTAGGGG + Exonic
1003839943 6:10109464-10109486 CAGTGTGACAAAGGGACTTGAGG + Intronic
1004204462 6:13578956-13578978 AGGTGGGAAAAGAGGCCTTGAGG - Intronic
1004325203 6:14668459-14668481 CAGAGGGACCAGAGGCCTGAGGG - Intergenic
1005814096 6:29537051-29537073 AAGTGGGCCAAGTGGCCTTTTGG + Intergenic
1006109835 6:31737772-31737794 TAGTGGGAGTAGAGTCCTTGGGG + Intronic
1006186501 6:32184357-32184379 CTTTGGGACAAGAGTCCTTCAGG + Intergenic
1007647655 6:43395406-43395428 AAGTCGGACAAGATGCTTTGAGG + Intergenic
1007746186 6:44044163-44044185 GAGTGGGACTGGAGGCCTGGAGG - Intergenic
1009276329 6:61685796-61685818 CAGTGGGACCAGGTACCTTGGGG + Intronic
1019213723 6:170426436-170426458 TAGTGTGACAGGAGGCCCTGAGG - Intergenic
1019919843 7:4156549-4156571 CAGTGGAAAAGCAGGCCTTGAGG + Intronic
1020788281 7:12594807-12594829 CAGAGGAACCAGAGGCCTGGAGG + Intronic
1021844857 7:24754606-24754628 CTCTTGGACAAGAGACCTTGTGG + Intronic
1022519355 7:30995936-30995958 CAGGGAGACAGGAAGCCTTGTGG + Intergenic
1023939253 7:44759507-44759529 CTGTGGGACAGGGGACCTTGGGG + Intronic
1027441041 7:78219503-78219525 CAGTAGTACGAGAGGCCCTGAGG - Intronic
1029450864 7:100641252-100641274 GATTGGGGCAAGAGGCCTGGGGG + Intronic
1029918803 7:104240040-104240062 CAGTGGGAAAAGATACCTGGGGG + Intergenic
1031952336 7:127905230-127905252 CAGAGGAACAAGAGGTCATGAGG - Intronic
1032396166 7:131591683-131591705 CAGTGGGAGAAGAGGCTAAGTGG - Intergenic
1032803908 7:135337664-135337686 CAGTGGGAAAGGGGCCCTTGGGG + Intergenic
1033313892 7:140282192-140282214 CAGGTGGACATGGGGCCTTGAGG + Intergenic
1039824104 8:41158221-41158243 CATTGGCACAAGAGGTCTGGAGG + Intergenic
1040871621 8:52105575-52105597 CAGTGGGGCAAGAGGCTAAGAGG + Intergenic
1042951296 8:74203219-74203241 CAGTGGGAAAGCAGGCCTTGTGG + Intergenic
1044860263 8:96516012-96516034 CAGTGTGACAACAGTACTTGGGG - Intronic
1044994798 8:97829021-97829043 CAGAGGAAAAAGAGTCCTTGAGG + Intronic
1048179168 8:132179764-132179786 CAGTGGGAGAAGAAGGCTTGGGG - Intronic
1048349457 8:133604215-133604237 CAGTGGGTCATGAGGTCTGGGGG - Intergenic
1048481261 8:134795879-134795901 GAGAAGGCCAAGAGGCCTTGAGG + Intergenic
1052560767 9:30079822-30079844 ATGTGGGAAAAGAGGTCTTGAGG + Intergenic
1053463836 9:38290614-38290636 CAGTAGGAAAAAAGGCCTGGTGG - Intergenic
1057046899 9:91893083-91893105 CTGTGGGAAGAGTGGCCTTGGGG - Intronic
1058539089 9:105993347-105993369 CAGAGGAACAAGAAGCATTGAGG - Intergenic
1059482018 9:114599030-114599052 CAGTGGCACAGCAAGCCTTGAGG - Intergenic
1059524048 9:114973430-114973452 CCGTGGGTCAAGTGACCTTGTGG + Intergenic
1059529398 9:115022105-115022127 CAGTGGGGCAAGGGGCCATGTGG - Intronic
1059959042 9:119547231-119547253 CAGTAGGTGAAGAGGACTTGGGG - Intergenic
1060263725 9:122097168-122097190 CAGTCATGCAAGAGGCCTTGCGG + Intergenic
1060940231 9:127539268-127539290 CACTGGGATGAGAGGCTTTGCGG - Intronic
1191132514 X:57030078-57030100 CATTTGGAGAAGAGGCCTTCTGG + Intergenic
1192860030 X:75057884-75057906 CAGTGGCACAAGAGGGTCTGTGG + Intronic
1197844104 X:130782878-130782900 CAATGGGACATGAGGGATTGGGG + Intronic
1198237885 X:134753087-134753109 CTGTGGGAAAGGAGGCTTTGTGG - Intronic
1201250697 Y:12054575-12054597 CAGTGGAATAAGAGACATTGGGG + Intergenic
1201519472 Y:14857636-14857658 CAGTTGGAGGAGAGGCCTAGTGG + Intergenic
1201963521 Y:19707629-19707651 AAGTCGGAGAAGAGGCCATGAGG + Exonic