ID: 933901504

View in Genome Browser
Species Human (GRCh38)
Location 2:86853616-86853638
Sequence CAGCTTGGTGTCCTGGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 1, 2: 1, 3: 30, 4: 252}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933901501_933901504 -8 Left 933901501 2:86853601-86853623 CCTAGAGATGGGGTTCAGCTTGG 0: 1
1: 0
2: 1
3: 22
4: 273
Right 933901504 2:86853616-86853638 CAGCTTGGTGTCCTGGAGAGAGG 0: 1
1: 1
2: 1
3: 30
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933901504 Original CRISPR CAGCTTGGTGTCCTGGAGAG AGG Intronic
900422271 1:2560737-2560759 CAGCTCTGTGCCCTGGGGAGGGG + Intronic
900867385 1:5277994-5278016 GAGCTTGGTTTCCTGGAGAAAGG + Intergenic
901235939 1:7667630-7667652 CTCCTGGGTGTCCTGGCGAGTGG + Intronic
901304846 1:8225381-8225403 CGTCTTGGTGTCCTGGATAGAGG - Intergenic
902053456 1:13581990-13582012 CAGCTGGGGGTCCTGGGGTGGGG - Intergenic
902120434 1:14160387-14160409 CATCTTAGTGTGCTGGAGAGAGG - Intergenic
902868231 1:19295323-19295345 AAGCCTGGTGTCCAGCAGAGGGG + Intergenic
903661937 1:24983786-24983808 CAGATTTGTGGCCTGGAGACTGG + Intergenic
906159854 1:43640036-43640058 CAGCCTGGTTCCCTGGGGAGGGG - Intergenic
906704695 1:47886409-47886431 CAGCTAGGTGTCCAGCAGTGAGG - Intronic
906949376 1:50322192-50322214 CTCCTTGGTGTCAAGGAGAGGGG - Intergenic
907314394 1:53559297-53559319 TGGCTTGGTGGACTGGAGAGAGG + Intronic
907850501 1:58250379-58250401 GAGCTGGGTATCCCGGAGAGGGG + Intronic
909426403 1:75530322-75530344 AAGCTTCATGTCCAGGAGAGTGG + Intronic
910841611 1:91567188-91567210 TAGCTTGGTGGCCAGGAGGGTGG - Intergenic
915284337 1:154843272-154843294 CAGCTTCTTGTTCTGGGGAGGGG - Intronic
915355247 1:155251819-155251841 CAGCATGGTGTGTAGGAGAGGGG + Exonic
918297835 1:183174052-183174074 AAGCATGGTTTCCTGGAGACAGG + Intergenic
918759042 1:188377763-188377785 TTGCTTGTTTTCCTGGAGAGTGG - Intergenic
919481651 1:198097396-198097418 AAGCGTGGTGTCTTGGAGAAGGG + Intergenic
919776445 1:201197207-201197229 CAGCTTGTTGATCTGCAGAGAGG - Exonic
920549459 1:206846364-206846386 CAGTTTTGTGTTCTGGGGAGAGG + Intergenic
921643858 1:217589298-217589320 CAGCATGGTGTCTTCTAGAGGGG - Intronic
923331839 1:232932564-232932586 CAGCTTGTTGTCCTGTGGAATGG - Intergenic
1063109453 10:3021971-3021993 TAGCTTCATGTCCTGAAGAGAGG + Intergenic
1063925796 10:10976011-10976033 CAGGTTGTTGCCCTGGAAAGGGG + Intergenic
1064555758 10:16545767-16545789 CGGCTTGGGGTTCTGCAGAGAGG + Intergenic
1065461173 10:25966082-25966104 TAACTTGGTGTCCTTGCGAGGGG + Intronic
1067458569 10:46440861-46440883 CAGCTTGGTGTGTTGGAAGGAGG - Intergenic
1067628629 10:47943775-47943797 CAGCTTGGTGTGTTGGAAGGAGG + Intergenic
1067664112 10:48258590-48258612 CACCTTGGAATCCTGAAGAGTGG - Intronic
1068142523 10:53025986-53026008 CAGTTTGGTGTCCTCCAGAGGGG + Intergenic
1070265274 10:74896172-74896194 CAGCATATGGTCCTGGAGAGAGG - Intronic
1071300153 10:84250374-84250396 CAGCATTTTGGCCTGGAGAGAGG - Intronic
1071735271 10:88291864-88291886 AAGGGTAGTGTCCTGGAGAGGGG - Intronic
1073136373 10:101222805-101222827 CGGCTTGGTGGCCTGGCGAGCGG - Intergenic
1074532941 10:114309501-114309523 CAGGTAGGTGTCCTGAAGCGTGG - Intronic
1075024719 10:118976060-118976082 CAGCTTTGAGGCCTGGAAAGAGG - Intergenic
1076777835 10:132707896-132707918 CAGCCAGGCGTCCTGGACAGTGG - Intronic
1077424329 11:2467278-2467300 CACCTTGGTGTCCGGCAGGGAGG + Intronic
1078011719 11:7577473-7577495 CAGCTTGGAGTTCTTGAGGGGGG + Intronic
1078718268 11:13859962-13859984 CAGCCTGGAGCCCTAGAGAGAGG - Intergenic
1081688586 11:45059651-45059673 AGGCTTGGTGTGCTGGAGAAAGG + Intergenic
1082032021 11:47611605-47611627 CATCTTGGAGACTTGGAGAGAGG + Intergenic
1084308259 11:68300500-68300522 AAGCTTGGAGTCCTGGGCAGGGG - Intergenic
1084591090 11:70091036-70091058 CGGCCTGTTCTCCTGGAGAGGGG + Intronic
1084801693 11:71548267-71548289 CAGCTTCTTCTCCTGCAGAGGGG - Intronic
1085104312 11:73829118-73829140 AAGCGTGGTATCCGGGAGAGTGG - Intronic
1085132247 11:74050718-74050740 CAGCTTGCTGTCCTTTAGACTGG + Intronic
1085316756 11:75549882-75549904 GAGCCTGGTGTGCTGGCGAGTGG - Intergenic
1087890293 11:103530596-103530618 CAGATTGCTTACCTGGAGAGTGG - Intergenic
1088584612 11:111351556-111351578 GGGCTTGTTGTCCAGGAGAGTGG - Intergenic
1092287101 12:7134934-7134956 CAGCTTGGTGCCCTGTGGGGTGG + Intronic
1095439511 12:42227772-42227794 CAGCGTGCTGTCCGGGAGGGAGG + Intronic
1096019281 12:48308575-48308597 CCGGTTGGTGGCCTGGAGATTGG + Intergenic
1096189822 12:49609193-49609215 CAGCTTGGTGACCTGTGGACTGG + Intronic
1100518601 12:95352000-95352022 CTGCTTGCTGGCCTGGAGACTGG + Intergenic
1101803504 12:108043333-108043355 CTGCTTTGTGTCTTCGAGAGTGG + Intergenic
1103601139 12:122055354-122055376 CAGAGTGATGCCCTGGAGAGGGG - Intronic
1103637905 12:122323569-122323591 CAGCTGTTTGACCTGGAGAGCGG + Intronic
1108808965 13:54196806-54196828 AAGCCTGATGTCCTGGAGAGGGG - Intergenic
1110615460 13:77536736-77536758 CAGCTCTGTGTCCTCCAGAGAGG + Intronic
1112155901 13:96816619-96816641 CAGCTGGCTCTCCTGAAGAGGGG - Intronic
1112312587 13:98332406-98332428 CAGCTTTGTGTTCTGCAAAGAGG - Intronic
1112788026 13:102972906-102972928 CATCCTGGCGTCCTGGAGTGAGG + Intergenic
1112966104 13:105196120-105196142 CAGCTGGTTGCCATGGAGAGGGG + Intergenic
1114473635 14:22980128-22980150 CAGCATGGGGTCCAGGAGTGGGG + Intronic
1114517100 14:23307181-23307203 CAGCGTGGAGCCCTGGAAAGGGG - Exonic
1117397854 14:55328672-55328694 AAACTTGTAGTCCTGGAGAGAGG + Intronic
1117880709 14:60310628-60310650 AAGCTAGGTGTTCTGGGGAGGGG + Intergenic
1118163002 14:63309682-63309704 CAGCTTGGTCTCCAGGCAAGGGG + Intergenic
1119639258 14:76302469-76302491 TAGGATGGAGTCCTGGAGAGGGG + Intergenic
1122534384 14:102451981-102452003 CAACTCGGTGCCCTGGAGGGAGG - Intronic
1124026240 15:25968835-25968857 GAGCATGGTGAACTGGAGAGAGG - Intergenic
1128798004 15:70478897-70478919 CAGCTGACTGTTCTGGAGAGGGG + Intergenic
1129748755 15:78044521-78044543 CAGCCTAGTGTCTTGGAGAGGGG + Intronic
1130103883 15:80914605-80914627 GAGCTTTGAGTCCAGGAGAGAGG - Intronic
1131056296 15:89377358-89377380 CAGCTTGGCTGCCTGGGGAGGGG + Intergenic
1131451379 15:92543115-92543137 CACATTGGTGTCCTGGGCAGAGG + Intergenic
1132590625 16:724871-724893 CTGCTTGGAGACCTGGAGGGTGG - Intronic
1133371819 16:5251059-5251081 CACCTCGGTGTCCTGGGGTGGGG + Intergenic
1133475248 16:6115033-6115055 CAGGTTGTTGTCATGGAAAGGGG + Intronic
1133840064 16:9399824-9399846 CAGCTTGCTTTCCTGGGGTGGGG + Intergenic
1134626265 16:15724885-15724907 CACCTGGGTGTCCTGGAGCTGGG + Exonic
1136365762 16:29808504-29808526 AAGCTTGGTGGGCTGGGGAGGGG - Intronic
1136460653 16:30408034-30408056 CATCTTGGTGTCCTGAGGCGGGG - Exonic
1136631831 16:31493459-31493481 CCGCTTGGTCTCCAGGTGAGTGG - Exonic
1138134163 16:54507419-54507441 CAGCTTGGTAGCCTGGTGGGGGG + Intergenic
1140091722 16:71845092-71845114 CAGCTTGGTTTAGTGGAAAGAGG - Intergenic
1141377994 16:83549263-83549285 CAGAGAGGTGACCTGGAGAGTGG - Intronic
1141417597 16:83888501-83888523 CAGCTCTGTATCATGGAGAGGGG + Intergenic
1142187190 16:88700167-88700189 CAGCCTGTTGCCCTGGACAGTGG - Intronic
1142386834 16:89770656-89770678 GAGCGTGGTGTCCTGGGGACGGG + Intronic
1143338524 17:6191440-6191462 CAGCTTGGTGTCTGGGATGGAGG - Intergenic
1144431746 17:15198758-15198780 CAGCTTGCTGTGCTGGTCAGGGG - Intergenic
1144541041 17:16143379-16143401 CAGCAAGGAGACCTGGAGAGAGG - Intronic
1146660864 17:34664480-34664502 GTGCTTGGTGTCCTGGAGTGCGG - Intergenic
1147264242 17:39225410-39225432 TACCTTGGTTTCCTGGAGGGCGG + Exonic
1147268318 17:39248296-39248318 CAGCTTTGTGTCAAGGGGAGAGG + Intergenic
1148358944 17:46996048-46996070 CTGCTTGCTTTCCTGGAGTGAGG + Intronic
1148676167 17:49446237-49446259 AAGATTGGTGTCCTGGGAAGTGG + Intronic
1149986868 17:61354032-61354054 CAGCGGGGTGGCCTGGTGAGTGG - Intronic
1150863049 17:68821144-68821166 CAGCCTGGAGCTCTGGAGAGTGG - Intergenic
1151349810 17:73525109-73525131 CTCCTTGGTGCCCTGGGGAGGGG - Intronic
1152563070 17:81088261-81088283 CAGCTTGGTGTTCTGGGGATGGG + Intronic
1152826718 17:82470826-82470848 CAGCTTTGTTACCTGGGGAGGGG + Intronic
1153564975 18:6410174-6410196 AAGCTTGGTGCCCTGGAGGAAGG - Intronic
1157937981 18:51894095-51894117 CCGCTAGGTGTGCTGGACAGGGG + Intergenic
1159168696 18:64735182-64735204 AAGCTTGGTGTCCTTGAGGAAGG + Intergenic
1160491907 18:79345108-79345130 CAGCTTGGATTCCAGGGGAGGGG + Intronic
1161326283 19:3665755-3665777 CAGCTTGTTGCCCTCGAGGGAGG + Intronic
1162743389 19:12786100-12786122 CAGCTTCCTCTCCAGGAGAGGGG + Intronic
1163337377 19:16682114-16682136 CAGCTTGGGGTCCTGGATTAGGG + Intronic
1163378159 19:16947022-16947044 CACTTTTGTGGCCTGGAGAGGGG + Intronic
1163452068 19:17384155-17384177 CAGGATGGTGCCCTGGAGACAGG + Intergenic
1163518952 19:17780705-17780727 CAGCTTGGGGTACAGGTGAGAGG + Intronic
1167211990 19:48139267-48139289 CAGCTTGGGACCCTGGTGAGGGG - Intronic
1167292417 19:48631456-48631478 AAGCTTGGTGCCCTGGTGATGGG + Intronic
1167637066 19:50661483-50661505 CAGCTGTGTGTGCTGGGGAGAGG + Intronic
1168331789 19:55574542-55574564 CAGTTTGTTGTCCTGGAAAAGGG + Intergenic
925058267 2:871903-871925 CAGCCTGGGGTCCTGGGCAGAGG + Intergenic
926515638 2:13841603-13841625 CAGCTCACTGTCCTGCAGAGAGG + Intergenic
926647086 2:15301754-15301776 CAGCTTGGAGGACTGGAGAAAGG + Intronic
926813277 2:16775309-16775331 CAGTTTGGGGTACTGGAGAAGGG + Intergenic
926831343 2:16965521-16965543 CAGCTTTGTGTCCTTGAGCAGGG - Intergenic
927081408 2:19634323-19634345 CCACTTGGTGTAATGGAGAGGGG - Intergenic
928361204 2:30663619-30663641 GAGCCTAGTGTCCTGGAGCGTGG + Intergenic
928439295 2:31278617-31278639 GGGCTTGGTGGCCTTGAGAGAGG - Intergenic
928547616 2:32343035-32343057 TATCCTGGTGTCCTGGAAAGAGG - Intergenic
930858115 2:56040700-56040722 CATCTTGGTGTCCGTGTGAGAGG + Intergenic
932844138 2:75117515-75117537 CAGCCTAGTGCCCTGGATAGGGG - Intronic
933901504 2:86853616-86853638 CAGCTTGGTGTCCTGGAGAGAGG + Intronic
934693057 2:96376669-96376691 GAGTTTGGTGTCCTGGAGCAAGG + Intergenic
935503908 2:103875062-103875084 CAGAGTGGTGTCCTTGGGAGAGG + Intergenic
935779043 2:106495620-106495642 CAGCTTTGTGTCCTGGAGAGAGG - Intergenic
936795418 2:116197026-116197048 TAACTTGGTGTCCTTGAAAGGGG + Intergenic
936825645 2:116577737-116577759 TAACTTGGTGTCCTTGTGAGGGG + Intergenic
938389321 2:130892773-130892795 GAGCTGGGAGTCCAGGAGAGGGG - Intronic
939859330 2:147398573-147398595 CAGCATGGTGTAATGCAGAGTGG - Intergenic
942343204 2:174972082-174972104 CAGCTTGTTGTCCTGGAAGCTGG - Intronic
946060508 2:216937009-216937031 CAGCTTGGGCGCCTGGAGACAGG - Intergenic
946278609 2:218649559-218649581 TTGCTTGGTTTCCTGCAGAGAGG - Intronic
947720546 2:232367136-232367158 CAGATTTGTCTCCTGGAGAGAGG + Intergenic
947902999 2:233738333-233738355 TAAATTGGTGTCATGGAGAGTGG + Intronic
947907369 2:233775213-233775235 CAACTTGGGGTCCCTGAGAGAGG - Intergenic
948022990 2:234752376-234752398 CAGCATGCTGTCGTGGAAAGAGG + Intergenic
948101591 2:235378571-235378593 GATCTCGGTGTCTTGGAGAGAGG + Intergenic
1169113945 20:3050572-3050594 CCGCATGTTGTCCTGGAGATGGG + Intergenic
1169569065 20:6887122-6887144 CAGGCTGATGTCCTGGAGAGAGG + Intergenic
1169967934 20:11237928-11237950 GAGCTTGGTGTCCTTGAGGTAGG - Intergenic
1170816348 20:19717668-19717690 GAGCTTGGTCTCCTGGTGACTGG + Intronic
1171345023 20:24459495-24459517 CAGCGTGGTGACCAGGAGTGAGG - Intergenic
1171570791 20:26249437-26249459 CAGCCTGGTCACTTGGAGAGAGG + Intergenic
1172480224 20:35267194-35267216 CGGCTGGGGGTCCTGGAGAGAGG - Exonic
1174452298 20:50627951-50627973 CAGCTGTGTGCCCTGGAGTGGGG - Intronic
1176098703 20:63355495-63355517 CTGCAGGGTGCCCTGGAGAGGGG - Intronic
1179252017 21:39678532-39678554 CAGCTGGGTGTCCTTGGGAAGGG + Intergenic
1180572951 22:16746453-16746475 CAGCCTGGTCACTTGGAGAGAGG + Intergenic
1182129950 22:27843629-27843651 CAGCTTGGTGCCCAGGAGGGAGG + Intergenic
1182189373 22:28442866-28442888 AAGGTAAGTGTCCTGGAGAGGGG - Intronic
1183561177 22:38574693-38574715 TAGCTGGGTGTCGTGGAGCGTGG + Intergenic
1183654571 22:39177229-39177251 GGGCTTGGTCTCCTGCAGAGTGG - Intergenic
949283874 3:2378463-2378485 CAGCTTAGTGCCCTGGAAAACGG + Intronic
950363262 3:12464735-12464757 CAGCTTCCTGGCCTGGAGAAAGG + Intergenic
950363723 3:12468437-12468459 CAGCTGGGTGGCCTGGAGCAAGG - Intergenic
951886990 3:27534051-27534073 CAGCTTGGCCTCCTGGTGATGGG + Intergenic
952189356 3:31006170-31006192 CAGCCTGGTGTTATGGAGATAGG + Intergenic
954328317 3:49875677-49875699 CAGGTTGGGGCACTGGAGAGGGG + Intergenic
955008347 3:54990678-54990700 CACCTTGCTTCCCTGGAGAGAGG - Intronic
955405679 3:58624310-58624332 CACCTTGGTGCCCTTGATAGGGG + Intronic
957104741 3:75872465-75872487 CAGCCTGGTCACTTGGAGAGAGG - Intergenic
959605905 3:108241800-108241822 CAGCTTGGTGTCCTGCCCACTGG + Intergenic
960428964 3:117545486-117545508 CAGCCAGAAGTCCTGGAGAGAGG + Intergenic
960933916 3:122883854-122883876 CTGCTGGGGATCCTGGAGAGGGG - Intergenic
961059502 3:123816527-123816549 CAGGTTGGTTCCCTGGAGTGTGG - Intronic
962061132 3:131928926-131928948 CTGGATGGTGTCCTGTAGAGAGG + Intronic
963488748 3:145971951-145971973 CAGCATGGTTTTCTGGAGTGAGG - Intergenic
965746739 3:171934258-171934280 CAGCTTGGTGTGCTGGAGGAAGG - Intronic
968914032 4:3489408-3489430 CGGCGTGGGGTCCTGGTGAGTGG + Intronic
969824652 4:9747822-9747844 CGGCTTGGTGCCCTGGGGATGGG - Intergenic
970432326 4:16000769-16000791 GGGCTTGGGGACCTGGAGAGGGG + Intronic
971364949 4:25970281-25970303 CAGCTGAGTGTCCTGGGGAGGGG - Intergenic
973162955 4:47041306-47041328 CAAGTTGGTCTCCTGGAAAGAGG + Intronic
975461243 4:74655872-74655894 CATCTTGGTGTCCTGAAGGGAGG - Intergenic
977699755 4:100007942-100007964 CAGCTTCTGGACCTGGAGAGAGG + Intergenic
978963037 4:114707487-114707509 CAGCTTGGTGTCTTAGAGATTGG + Intergenic
979223925 4:118263901-118263923 CAGCTTGGTGTCAAGGAGGAAGG - Intergenic
979725326 4:123954285-123954307 CAGCTTGGGCTCCTGGACAAAGG + Intergenic
981097824 4:140799561-140799583 CAGCTTGGAGTTCAGAAGAGAGG - Intergenic
981567479 4:146115983-146116005 CAGCCTCCTGCCCTGGAGAGGGG + Intergenic
981629253 4:146799115-146799137 CAGCTTGGTGTCATTCAGAGAGG - Intronic
981908586 4:149952530-149952552 CAAGTTGTTGTCCTGGAGTGGGG - Intergenic
985490716 5:176921-176943 CAGCTGGGTCACCTGGAAAGTGG + Intronic
985691146 5:1313344-1313366 CAGCATTGTGTGCTGGAGAAGGG + Intergenic
985869689 5:2544632-2544654 CAGATTGGCTTCATGGAGAGGGG + Intergenic
985979771 5:3452675-3452697 CAGCTTGGTTTCCCGGAGCTGGG + Intergenic
986174948 5:5344128-5344150 CATCTTGGTGTCTGGGAGAGAGG - Intergenic
989357013 5:40554936-40554958 CAGCTTGGTGTCATGCAGTCAGG - Intergenic
989504955 5:42216384-42216406 TAAATTGGTGTCCTTGAGAGCGG + Intergenic
991406906 5:66308884-66308906 CAGCTTGGTGTCATGGCGGGAGG - Intergenic
992635199 5:78719996-78720018 CAGCAGAGTGTCCTGGAGAGGGG - Intronic
995654519 5:114410197-114410219 GAGCTTGGGGTCCTGAAGATTGG + Intronic
996193068 5:120569311-120569333 CAGTTTGATGCTCTGGAGAGAGG + Intronic
996295039 5:121903124-121903146 CATCGTTTTGTCCTGGAGAGTGG + Intergenic
997406854 5:133655997-133656019 CAGCATAGTGACCTGGAGGGCGG - Intergenic
997859964 5:137407449-137407471 CAGCTTGGTGTACCTGAGAGGGG + Intronic
998368563 5:141646703-141646725 CAGGTGTGTGTCCTGGAGTGGGG - Exonic
998569504 5:143244669-143244691 CAGCTTGGGATTCTGGAGGGAGG - Intergenic
999193405 5:149765329-149765351 GAGCTCGGGGTCCTGGAGAGAGG - Intronic
999201132 5:149817031-149817053 CAGCTTGGTGACCAGGGGTGGGG - Intronic
1000374704 5:160568502-160568524 CAGCGTGGTGAGATGGAGAGAGG + Intronic
1000454792 5:161436613-161436635 TAACTTGGTGTCCTTGTGAGGGG - Intronic
1001453783 5:171845757-171845779 CAACTTGGAGTCCGGGAAAGGGG + Intergenic
1001747654 5:174104118-174104140 CAGCATGGTGTGCTAGAAAGGGG - Intronic
1001820753 5:174708402-174708424 CAGGTTGGTGTCTAGGGGAGGGG - Intergenic
1003028770 6:2581943-2581965 CAGGTTGGAGTCTAGGAGAGAGG - Intergenic
1004095015 6:12545051-12545073 CAGCTTGGTTTCCTGGCATGAGG - Intergenic
1004602470 6:17163537-17163559 CAGCATGGTGTCTTGGAGGGTGG - Intergenic
1005761748 6:28973863-28973885 GAGCTAAGAGTCCTGGAGAGAGG + Intergenic
1006519120 6:34561393-34561415 CAACATGGTGTCCTGGAGAGAGG - Intergenic
1007110341 6:39310037-39310059 GATACTGGTGTCCTGGAGAGAGG + Intronic
1007607797 6:43129106-43129128 CCGCTCCGTGTCCTGGACAGGGG - Exonic
1008916503 6:56793143-56793165 CATCTTGGAGTCCTGGAGGGTGG + Intronic
1009525982 6:64747040-64747062 CAGATGGGTGGCCTGCAGAGTGG - Intronic
1009595565 6:65730910-65730932 AAGCTGCGTGGCCTGGAGAGTGG + Intergenic
1009884952 6:69614926-69614948 CATCTTGGTATCCTGGGGGGAGG + Intergenic
1013054870 6:106573894-106573916 CATCTTGGTGGCCTGGACACAGG - Intronic
1013732498 6:113184999-113185021 CAGCTTTGCTTCCTGGAGACTGG + Intergenic
1016927228 6:149362701-149362723 TGGCTTGGTGTACTGGGGAGGGG + Intronic
1018833112 6:167461252-167461274 CAGGTTGGTGTGAAGGAGAGAGG + Intergenic
1018958719 6:168431492-168431514 CAGCTAGGGGTTCTGAAGAGAGG - Intergenic
1019017746 6:168892102-168892124 CAGCTCAGTGTCCAGGAGTGGGG + Intergenic
1020265742 7:6558958-6558980 CAGGGTGGTGGCCTGGAAAGTGG - Intergenic
1021858196 7:24878924-24878946 CAGCCTGGTCTCCTGGAATGTGG - Intronic
1026765314 7:73155945-73155967 CTCCTTGGGGTCCTGGAAAGGGG + Intergenic
1026915168 7:74115720-74115742 TGGCTTGGGGTCCTGGGGAGGGG + Intronic
1027041788 7:74965701-74965723 CTCCTTGGGGTCCTGGAAAGGGG + Intronic
1027081854 7:75236668-75236690 CTCCTTGGGGTCCTGGAAAGGGG - Intergenic
1028103757 7:86853087-86853109 AAGCTTGGTGTCTAGGACAGTGG + Intronic
1028838382 7:95399188-95399210 AAGATTGGGGTCGTGGAGAGTGG + Intergenic
1029390442 7:100271214-100271236 CTCCTTGGGGTCCTGGAAAGGGG - Intronic
1029505326 7:100960447-100960469 CTGCTTGGTTTCATGGTGAGCGG - Exonic
1029668638 7:102012679-102012701 CCACTCTGTGTCCTGGAGAGTGG + Intronic
1031427547 7:121624594-121624616 AAACTTGGTTTCCTTGAGAGAGG - Intergenic
1031732732 7:125318462-125318484 CTGCTTGGTGTCCTATAGGGAGG - Intergenic
1033042823 7:137933796-137933818 CAGCTGGGTGTCCTTGGCAGTGG + Intronic
1033428138 7:141263992-141264014 CCCCTTGGAGTCATGGAGAGTGG + Intronic
1034536421 7:151728497-151728519 CAGCTTGGTGACCTGGGGTTGGG - Intronic
1034696856 7:153061379-153061401 AAGCCTGAGGTCCTGGAGAGAGG - Intergenic
1035577343 8:716243-716265 CAGGGTGATGCCCTGGAGAGAGG - Intronic
1035815160 8:2531111-2531133 CAGGTAAGTGTCCTGGAGGGAGG + Intergenic
1036756535 8:11474987-11475009 CAGCCAAGTGTCCTGGAGTGAGG + Intergenic
1039144002 8:34424581-34424603 CAACTTGTTGTCCTGAAGAATGG + Intergenic
1039847168 8:41333803-41333825 CAGATTGTTGTCATGGAAAGGGG - Intergenic
1040977955 8:53214998-53215020 CAGCTTTGGGTTCTGGTGAGGGG - Intergenic
1041084565 8:54244855-54244877 CTGCTTGACGTTCTGGAGAGAGG + Intergenic
1042936201 8:74060976-74060998 TACCTTCGTGTCCTGGAGAATGG + Intergenic
1048850025 8:138636178-138636200 CAGCTGGTTGTGCTGGATAGAGG + Intronic
1049190092 8:141282520-141282542 CTGAGTGGTGGCCTGGAGAGAGG - Intronic
1050291390 9:4159003-4159025 CAGCTTGGTATGCTAGAGAAAGG + Intronic
1051506200 9:17830354-17830376 GAGCCTGGTGTGTTGGAGAGTGG - Intergenic
1052278499 9:26705787-26705809 CAGGTTGGTATCCTGGAGATTGG + Intergenic
1056389707 9:86129713-86129735 CAGCCATGTGACCTGGAGAGTGG - Intergenic
1056625491 9:88249688-88249710 CAGCTTGGTGTCCTTGGGTCAGG - Intergenic
1056697047 9:88867617-88867639 CAGCTTTGTGCTCTGGGGAGAGG + Intergenic
1057569200 9:96190984-96191006 CAGCTTGGTGAGTTGGAGAGAGG - Intergenic
1058969320 9:110065473-110065495 CACCTTGGTGTCCCAGAGTGTGG + Intronic
1059219814 9:112604323-112604345 GAGATTTGTGACCTGGAGAGGGG - Intronic
1060557926 9:124518921-124518943 CAGCTTTCTGTCCTGCTGAGAGG + Exonic
1060880013 9:127111505-127111527 CAGCTGGGAGTGCTGGAAAGAGG + Intronic
1062230827 9:135480406-135480428 GAGCTTGGGGCCCGGGAGAGCGG - Intronic
1062349142 9:136130681-136130703 CAGCCTGGTGTCCTCGGGACAGG - Intergenic
1062464317 9:136674444-136674466 CAGCTTGGGGGCCTGGAGGGCGG - Intronic
1186405753 X:9300871-9300893 CAGCTTGCTGCCCTCAAGAGTGG - Intergenic
1189744276 X:44154151-44154173 CAGATTGGTGTGCTCCAGAGTGG - Intronic
1191995355 X:67089373-67089395 CATCTAGGTGTCCTGAAGACAGG - Intergenic
1192165087 X:68823157-68823179 CTGCTTTGTGTCCTGGAGAAAGG + Intergenic
1192762218 X:74105372-74105394 CAGCTTGGCGGCCTGGCAAGCGG + Intergenic
1194193186 X:90861488-90861510 AGGCTTGGTGTTCTGGGGAGAGG - Intergenic
1195259774 X:103120875-103120897 CTGCGTTGAGTCCTGGAGAGGGG - Intergenic
1195828932 X:109033725-109033747 TAACTTGGTGTCCTTGTGAGGGG + Intergenic
1196108772 X:111924013-111924035 TAGATTGCTGTCCTGGAAAGAGG + Intronic
1197752895 X:129977720-129977742 CAGCTTGGTGTAATGGAAAGAGG - Intergenic
1200539800 Y:4443938-4443960 AGGCTTGGTGTTCTGGGGAGAGG - Intergenic
1201255787 Y:12107077-12107099 CAGCTTGGTCTGCTGGACAAAGG + Intergenic