ID: 933902205

View in Genome Browser
Species Human (GRCh38)
Location 2:86858166-86858188
Sequence CTGTGTTTCGGGATGCAAGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 2, 1: 0, 2: 0, 3: 7, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933902205_933902209 9 Left 933902205 2:86858166-86858188 CCGGCTTGCATCCCGAAACACAG 0: 2
1: 0
2: 0
3: 7
4: 119
Right 933902209 2:86858198-86858220 CCTGTTCCACCTCTTCACCGTGG 0: 2
1: 0
2: 1
3: 15
4: 117
933902205_933902212 25 Left 933902205 2:86858166-86858188 CCGGCTTGCATCCCGAAACACAG 0: 2
1: 0
2: 0
3: 7
4: 119
Right 933902212 2:86858214-86858236 ACCGTGGATAGTCCCTTTTGCGG 0: 2
1: 0
2: 0
3: 4
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933902205 Original CRISPR CTGTGTTTCGGGATGCAAGC CGG (reversed) Exonic
901334016 1:8433170-8433192 CTGTGTTCCTGGGTGCAAGATGG + Intronic
902247567 1:15131089-15131111 CTGTGAGTCAGGATGAAAGCTGG - Intergenic
904671917 1:32172366-32172388 CTGAGTTTCCTGATACAAGCAGG - Exonic
910280361 1:85493999-85494021 GTATGTTTTGGGATGCAACCAGG + Intronic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
913597055 1:120388625-120388647 CTGTTCTTTGGGATGAAAGCAGG + Intergenic
914005455 1:143728956-143728978 CTGTTCTTTGGGATGAAAGCAGG - Intergenic
914090266 1:144490681-144490703 CTGTTCTTTGGGATGAAAGCAGG - Intergenic
914096828 1:144551316-144551338 CTGTTCTTTGGGATGAAAGCAGG - Intergenic
914097935 1:144560215-144560237 CTGTTCTTTGGGATGAAAGCAGG - Intergenic
914198637 1:145465186-145465208 CTGTTCTTTGGGATGAAAGCAGG - Intergenic
914301055 1:146377398-146377420 CTGTTCTTTGGGATGAAAGCAGG + Intergenic
914308339 1:146443541-146443563 CTGTTCTTTGGGATGAAAGCAGG + Intergenic
914477744 1:148038321-148038343 CTGTTCTTTGGGATGAAAGCAGG - Intergenic
914517677 1:148388048-148388070 CTGTTCTTTGGGATGAAAGCAGG - Intergenic
914593770 1:149129592-149129614 CTGTTCTTTGGGATGAAAGCAGG - Intergenic
918058917 1:181045631-181045653 CAGTGTTATGGGATCCAAGCTGG - Intronic
921087011 1:211803899-211803921 CTGTATTTCGTCATGCATGCTGG - Intronic
921329283 1:214019566-214019588 CTGAGGGTCGGGATGCAGGCAGG - Intronic
1065671293 10:28121059-28121081 CAGTGTTTTGGGAGGCAAGGTGG + Intronic
1065790434 10:29255240-29255262 TTCTGTTTCTGGATGCCAGCTGG + Intergenic
1066414673 10:35210097-35210119 ATGTGGTTCAGGATGCTAGCTGG + Intronic
1068788382 10:61001539-61001561 CTGTGGCCCGGGATGCAGGCGGG - Intergenic
1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG + Intergenic
1075312085 10:121422827-121422849 CTGAGCTTTGGGATGAAAGCAGG + Intergenic
1075786460 10:125053420-125053442 CTGTGTTGGGGGATGCCAGGAGG - Intronic
1075850514 10:125582403-125582425 CTGTTTTTAGGGATGCACCCTGG - Intronic
1077824922 11:5796566-5796588 ATGTGTTTCGGTAAGCGAGCTGG + Intronic
1078381794 11:10848974-10848996 CTGTGTGTGGTGATGCATGCTGG - Intronic
1078456910 11:11482581-11482603 CTGTGTATGGGAATCCAAGCTGG - Intronic
1079051400 11:17163558-17163580 CTGTGTGTGGTGATGCACGCTGG - Intronic
1083715898 11:64576844-64576866 CTGGGTTGGGGGAGGCAAGCAGG - Intergenic
1085990102 11:81831080-81831102 CTGAGTATGGGGATGCAAGGTGG - Intergenic
1092406054 12:8222773-8222795 CTCTCTTTCAGGTTGCAAGCGGG - Exonic
1094043383 12:26141263-26141285 CTGTGTTTGGGGATGGAGGAAGG + Intronic
1095991840 12:48040148-48040170 CTGTGTCTCCCGATCCAAGCTGG - Intergenic
1097187347 12:57202903-57202925 CTGTGTTTGGGGAGGGGAGCGGG - Intronic
1102788822 12:115626498-115626520 CTGTGTTTAGGGATGGAATTTGG - Intergenic
1105759931 13:23504249-23504271 GTGTGTTGTGGGATGCCAGCAGG - Intergenic
1111131751 13:83985977-83985999 CAGTATTTCGGGAGGCAAACAGG - Intergenic
1126930589 15:53645303-53645325 TTGTGTTTCAGGCTTCAAGCTGG + Intronic
1130044938 15:80436193-80436215 CTGAGTTTCAGGATGCTGGCAGG + Intronic
1130835356 15:87644803-87644825 CTGTGTTAAGGGATGCAGGCAGG - Intergenic
1133899396 16:9959308-9959330 CTAGGTTTAGGGATGGAAGCTGG - Intronic
1138639129 16:58368922-58368944 CTGGTTTTGGGGATGCTAGCTGG - Intronic
1139018490 16:62719207-62719229 TTGTGTTTCTGGATGAAGGCAGG + Intergenic
1139636035 16:68259098-68259120 CTGTGCTTAGGAATGCCAGCTGG - Intronic
1140753925 16:78050269-78050291 TTGTAGTTTGGGATGCAAGCTGG - Intronic
1150434155 17:65141107-65141129 CTGTGGGTCGGGATGCCCGCCGG + Intronic
1152531151 17:80920002-80920024 CTGGGTTTGGAGATGCAAACTGG - Intronic
1153320957 18:3773925-3773947 CTGTGATTGGGAATCCAAGCTGG + Intronic
1159042780 18:63340899-63340921 CTGTGTTGTGGGAGGCAAGCAGG - Intronic
1162056237 19:8065810-8065832 CTGAGTTTCGGGGTTCAATCTGG + Exonic
925598889 2:5588086-5588108 CTGTGCTTTGGGATGAAAGCAGG + Intergenic
930019654 2:46993872-46993894 CTGTGTTGGGGCAGGCAAGCAGG - Intronic
933902205 2:86858166-86858188 CTGTGTTTCGGGATGCAAGCCGG - Exonic
935708595 2:105877616-105877638 CTCTGCTTGGGCATGCAAGCAGG + Intronic
935778339 2:106491102-106491124 CTGTGTTTCGGGATGCAAGCCGG + Intergenic
938675823 2:133632952-133632974 CGGTGTGTCCAGATGCAAGCTGG - Intergenic
945145519 2:206734081-206734103 CTGAGTTTCTGGAAGCAAACTGG - Intergenic
1169004743 20:2197154-2197176 CGGTGTTTGGGGGTGCAAGGAGG - Intergenic
1169534606 20:6525076-6525098 CTGGGTACCGGGATGCCAGCTGG + Intergenic
1173290724 20:41712685-41712707 CTGTGTTTAGGGAAGCAGGCTGG - Intergenic
1174130536 20:48340828-48340850 CTGGGCTGCGGGAGGCAAGCTGG - Intergenic
1174394497 20:50238288-50238310 CTGTGTGATGGAATGCAAGCCGG + Intergenic
1175550195 20:59812577-59812599 CTGTGGTTTGGGCTGCAAGGCGG + Intronic
1177816825 21:25986927-25986949 GTGTGTTTAGGGATGCAAATGGG - Intronic
1177900752 21:26912395-26912417 CTGTGAATCAGGATGTAAGCAGG - Intergenic
1178746357 21:35254278-35254300 CTGTGTTTAGTAATGCAAACAGG - Intronic
1179152603 21:38821751-38821773 CTGAGTTTTTGAATGCAAGCAGG - Intronic
1182213889 22:28699926-28699948 TTGTGTTTCAGGATGGAAGGGGG - Exonic
1183187752 22:36301783-36301805 CTGTGGTGGGGGCTGCAAGCAGG + Intronic
950677232 3:14561666-14561688 ATTTGTTTCGGGAAGCAGGCGGG - Intergenic
956305631 3:67821331-67821353 AGGTGTGTCTGGATGCAAGCTGG - Intergenic
956911497 3:73822290-73822312 CTGTGTTTTGGAATGCGAGAAGG + Intergenic
959976460 3:112466262-112466284 CTTTGTTTCAGGATGCAGGAAGG - Exonic
962318650 3:134374037-134374059 CAGTGTTTCGGGTTGCAGGTCGG - Intronic
962326100 3:134433582-134433604 CTGTTTTTCCCCATGCAAGCAGG + Intergenic
962492522 3:135908306-135908328 TTGTCTTGCGGGAGGCAAGCAGG - Intergenic
965635905 3:170780242-170780264 CTGTGTTTCTGGATGCAGGAGGG - Intronic
965687560 3:171320874-171320896 CTGTGTTTAGGCAAGCCAGCAGG - Intronic
966557599 3:181281047-181281069 CTGTGTTCCAGGATCCAACCCGG - Intergenic
966882371 3:184357680-184357702 CTGTGTTCCGGGATTCATTCTGG + Exonic
973084374 4:46037045-46037067 ATGTGTTTAGAGATGCGAGCTGG - Exonic
982281494 4:153687914-153687936 CAGTGTTTGGTGTTGCAAGCAGG + Intergenic
985421046 4:189785503-189785525 CTGAGTTTCTGGATGCAAATTGG - Intergenic
987337922 5:16913608-16913630 CTGTGTTTCTGTAAGCAGGCAGG - Intronic
989807274 5:45624779-45624801 TTGTGTTTATGGAGGCAAGCAGG + Intronic
990680190 5:58233950-58233972 CTGTGATTGGGGTTGCCAGCAGG - Intergenic
995597172 5:113760253-113760275 CAAGGTTTAGGGATGCAAGCAGG - Intergenic
997439371 5:133898620-133898642 CTGAGCTTCTGGATGCAAGCAGG - Intergenic
1003245470 6:4378622-4378644 CTCTGTTTCTGGATGCTTGCAGG - Intergenic
1014003335 6:116389323-116389345 CAGTGTTTGAGGGTGCAAGCTGG - Intronic
1021807705 7:24373555-24373577 CTGTGAGTCGGGATGCAGACAGG - Intergenic
1023263871 7:38384914-38384936 TTGTTTTTCAGGATGCAGGCTGG - Exonic
1025896335 7:65705143-65705165 GTGTGTTTTGGGTTGCATGCAGG - Intergenic
1027739541 7:81983128-81983150 CTGTGTTTTCATATGCAAGCTGG - Intronic
1035636047 8:1145180-1145202 CTGTGTTTCTGGATGGTGGCTGG - Intergenic
1036263689 8:7258941-7258963 CTCTCTTTCAGGTTGCAAGCGGG + Intergenic
1036264990 8:7266563-7266585 CTCTCTTTCAGGTTGCAAGCGGG + Intergenic
1036266291 8:7274185-7274207 CTCTCTTTCAGGTTGCAAGCGGG + Intergenic
1036267592 8:7281807-7281829 CTCTCTTTCAGGTTGCAAGCGGG + Intergenic
1036268895 8:7289429-7289451 CTCTCTTTCAGGTTGCAAGCGGG + Intergenic
1036297694 8:7550003-7550025 CTCTCTTTCAGGTTGCAAGCGGG - Intergenic
1036298998 8:7557651-7557673 CTCTCTTTCAGGTTGCAAGCGGG - Intergenic
1036300303 8:7565301-7565323 CTCTCTTTCAGGTTGCAAGCGGG - Intergenic
1036301610 8:7572946-7572968 CTCTCTTTCAGGTTGCAAGCGGG - Intergenic
1036302908 8:7580595-7580617 CTCTCTTTCAGGTTGCAAGCGGG - Intergenic
1036315730 8:7717480-7717502 CTCTCTTTCAGGTTGCAAGCGGG + Intergenic
1036317039 8:7725128-7725150 CTCTCTTTCAGGTTGCAAGCGGG + Intergenic
1036318346 8:7732776-7732798 CTCTCTTTCAGGTTGCAAGCGGG + Intergenic
1036319655 8:7740423-7740445 CTCTCTTTCAGGTTGCAAGCGGG + Intergenic
1036320962 8:7748071-7748093 CTCTCTTTCAGGTTGCAAGCGGG + Intergenic
1036322272 8:7755719-7755741 CTCTCTTTCAGGTTGCAAGCGGG + Intergenic
1036323581 8:7763367-7763389 CTCTCTTTCAGGTTGCAAGCGGG + Intergenic
1036324878 8:7771015-7771037 CTCTCTTTCAGGTTGCAAGCGGG + Intergenic
1036351159 8:8013293-8013315 CTCTCTTTCAGGTTGCAAGCGGG - Intergenic
1036352463 8:8020939-8020961 CTCTCTTTCAGGTTGCAAGCGGG - Intergenic
1036353758 8:8028587-8028609 CTCTCTTTCAGGTTGCAAGCGGG - Intergenic
1036846439 8:12173712-12173734 CTCTCTTTCAGGTTGCAAGCCGG - Intergenic
1036867802 8:12416031-12416053 CTCTCTTTCAGGTTGCAAGCCGG - Intergenic
1042306382 8:67337601-67337623 GTGTGTTTCAGGATGCAAGGAGG - Intronic
1045429258 8:102098060-102098082 CTGTGTTTGGGTATGAAAGGTGG + Intronic
1056867642 9:90243610-90243632 CAGTGTTTTGGGGTGCAATCGGG + Intergenic
1057134295 9:92676210-92676232 CTGTGTTTAGAAATGCAAGATGG + Intergenic
1061510314 9:131057047-131057069 CTGTGCTCCGGGATACAAGAGGG + Exonic
1061946255 9:133909809-133909831 ATGTGTTTTGGGATGTAAGAGGG - Intronic
1189911197 X:45812041-45812063 CTATGTTTCAGGAGGCAAGAAGG - Intergenic