ID: 933904314

View in Genome Browser
Species Human (GRCh38)
Location 2:86874669-86874691
Sequence AGCTTGATAATTATTAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933904309_933904314 21 Left 933904309 2:86874625-86874647 CCCAAAGTGCTGGGATTACAGGC No data
Right 933904314 2:86874669-86874691 AGCTTGATAATTATTAAAACTGG No data
933904311_933904314 -7 Left 933904311 2:86874653-86874675 CCACCATGCTCAGCCAAGCTTGA No data
Right 933904314 2:86874669-86874691 AGCTTGATAATTATTAAAACTGG No data
933904310_933904314 20 Left 933904310 2:86874626-86874648 CCAAAGTGCTGGGATTACAGGCA No data
Right 933904314 2:86874669-86874691 AGCTTGATAATTATTAAAACTGG No data
933904312_933904314 -10 Left 933904312 2:86874656-86874678 CCATGCTCAGCCAAGCTTGATAA No data
Right 933904314 2:86874669-86874691 AGCTTGATAATTATTAAAACTGG No data
933904305_933904314 30 Left 933904305 2:86874616-86874638 CCTCGGCCTCCCAAAGTGCTGGG No data
Right 933904314 2:86874669-86874691 AGCTTGATAATTATTAAAACTGG No data
933904307_933904314 24 Left 933904307 2:86874622-86874644 CCTCCCAAAGTGCTGGGATTACA No data
Right 933904314 2:86874669-86874691 AGCTTGATAATTATTAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933904314 Original CRISPR AGCTTGATAATTATTAAAAC TGG Intergenic