ID: 933906028

View in Genome Browser
Species Human (GRCh38)
Location 2:86893360-86893382
Sequence CACCTACCATAACTGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 1, 2: 1, 3: 9, 4: 86}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933906028 Original CRISPR CACCTACCATAACTGGAGCT GGG (reversed) Intergenic
902045281 1:13519290-13519312 CACCAACCATGCCAGGAGCTGGG - Intergenic
905838024 1:41146480-41146502 CACTTACCTTGAATGGAGCTTGG - Intronic
907760563 1:57354770-57354792 GAGCTACCATAACTGGAGACAGG + Intronic
920987004 1:210900305-210900327 CTCCTATCAGAACTTGAGCTGGG + Intronic
922479979 1:225933237-225933259 CACTTGCCATGAATGGAGCTTGG + Intergenic
1063132283 10:3188710-3188732 CACCAACCGGAAGTGGAGCTCGG - Intergenic
1065194265 10:23247256-23247278 CACTTACCATGAATGGAGCATGG - Intergenic
1070151561 10:73808368-73808390 CACCTTCCACAACTGGAGCATGG + Exonic
1074968197 10:118512041-118512063 CACCTCCCAAAACGGGAGGTTGG - Intergenic
1078911320 11:15735095-15735117 CACATACCAAATCAGGAGCTAGG - Intergenic
1082806970 11:57457939-57457961 CCCCAACCCTAACCGGAGCTAGG + Intergenic
1083515174 11:63250909-63250931 CCCAAACCATAACTGGAGCTGGG - Intronic
1089715901 11:120358996-120359018 CACCTACCAACAGAGGAGCTAGG - Intronic
1095224338 12:39661883-39661905 CACCTTCAATAAATGGTGCTGGG - Intronic
1103121761 12:118386326-118386348 CACTTTCCATAACTGCAGCTTGG - Intronic
1104554304 12:129786206-129786228 CAGCTCCCATAACGGGAGCAAGG - Intronic
1106425142 13:29621543-29621565 CACTTACCATGAATGGAACTTGG + Intergenic
1106554802 13:30800257-30800279 CACCTACCATGTCTGGATTTTGG + Intergenic
1107015958 13:35707823-35707845 CACCGACCATCACTGGGGGTGGG - Intergenic
1107874534 13:44778458-44778480 CACCTACCACGAATAGAGCTTGG + Intergenic
1108039372 13:46324981-46325003 CTCCTCCCATAAATGGACCTGGG - Intergenic
1110734199 13:78915987-78916009 CACCTACCATGAATAGATCTGGG - Intergenic
1111351481 13:87036760-87036782 CACAAACCATAACTACAGCTTGG + Intergenic
1111799901 13:92968649-92968671 CACCTTCCATTTCTGGACCTTGG + Intergenic
1114526099 14:23367630-23367652 CCTCTAACCTAACTGGAGCTGGG - Intergenic
1118570115 14:67186494-67186516 CAACTACCACAACTAGGGCTGGG + Intergenic
1122882210 14:104695245-104695267 CACCTACCATGGCTGTGGCTGGG - Intronic
1124689178 15:31807553-31807575 ATCCTGCCAAAACTGGAGCTGGG - Intronic
1126660040 15:51023973-51023995 CACCTACCATGACTGCAGAAGGG - Intergenic
1127310973 15:57752192-57752214 CTCCTATCATACCTGGGGCTGGG - Intronic
1142679994 17:1541696-1541718 CATCTCCCATTACTGGAGATGGG + Intronic
1146500405 17:33359474-33359496 CTTCTACCAGAACTGGAGCTTGG - Intronic
1148750162 17:49940981-49941003 CAGCTACCATGTCGGGAGCTTGG - Intergenic
1150863268 17:68823095-68823117 CACCTACTCTAACAGGAGCAGGG - Intergenic
1157501395 18:48193391-48193413 CACCTACTATATCTGGTGTTGGG - Intronic
1161317139 19:3622597-3622619 CACCGGCCATGACTGGAGCTGGG + Intronic
1161337319 19:3721626-3721648 CACCTCCCATCACAGGAGCCAGG - Intronic
1167860039 19:52275592-52275614 CACTTACCATGAATGGAGCTTGG - Intronic
925182892 2:1828292-1828314 CACCTACCATTAGGGAAGCTGGG - Intronic
929897132 2:45971123-45971145 CATCTTGCATAACTGGAACTTGG + Intronic
930771649 2:55135999-55136021 CACCTAACATGCCTGGAGGTGGG - Intergenic
933906028 2:86893360-86893382 CACCTACCATAACTGGAGCTGGG - Intergenic
935766871 2:106376530-106376552 CACCTACCGTAAGTGGAGCTGGG - Intergenic
936035827 2:109110368-109110390 CATCTACCATCATTGGAACTTGG + Intergenic
936366135 2:111858299-111858321 CACCTACCGTAACTGGAGCTGGG + Exonic
940972130 2:159905753-159905775 CACCTGCCATCACAGGATCTGGG + Intergenic
947789910 2:232859424-232859446 CAACCAACAAAACTGGAGCTGGG - Intronic
1169130707 20:3165213-3165235 CAGCTACCAGATCTGGAGCCAGG + Intronic
1169146931 20:3258843-3258865 CATTTACCGTAACTGGAGCCTGG - Intronic
1170253319 20:14311187-14311209 CACTTACCACAAATGGAGCTTGG - Intronic
1178073485 21:28994080-28994102 CAGCTACCATTCCTAGAGCTAGG - Intergenic
953885458 3:46712341-46712363 CTCCTACCAACACTGGATCTGGG - Exonic
958906735 3:99950147-99950169 CACCTACTGTAACTGTAGATAGG + Intronic
966114492 3:176445295-176445317 CACCTACCCCAAAAGGAGCTGGG + Intergenic
967406419 3:189120372-189120394 CATTTACCATAACTGCAGGTGGG - Intronic
967407532 3:189134201-189134223 CACCTGCCATCTCTGGGGCTTGG + Intronic
973253683 4:48086935-48086957 AACCTACCAAAACTAGACCTGGG + Intronic
984817111 4:183849166-183849188 CAGTTACCAAAATTGGAGCTTGG + Intergenic
987245043 5:16040289-16040311 CATCCACCATGACTGTAGCTAGG + Intergenic
987456705 5:18156159-18156181 CAGGTATAATAACTGGAGCTTGG + Intergenic
987683617 5:21167995-21168017 TACCTATAATAACTGGACCTTGG - Intergenic
988186846 5:27875118-27875140 CACTTACAATAAATGGAGCTTGG - Intergenic
988268865 5:28988031-28988053 CACATACCATTACTGGAAATTGG + Intergenic
991708101 5:69379310-69379332 AACTTACCATGAATGGAGCTTGG + Intronic
992816323 5:80443492-80443514 CAACCACCACAACTGGAGTTTGG + Intronic
992892264 5:81214353-81214375 TACCTACCATGACTGGAGTAAGG - Intronic
995258381 5:110073166-110073188 CACCTCCCTTGACTGGAGGTGGG + Intergenic
1001221792 5:169906673-169906695 CACATACCTGAGCTGGAGCTGGG + Intronic
1001225210 5:169938579-169938601 CACTTGCCATGAATGGAGCTTGG + Intronic
1002532387 5:179855791-179855813 CACCTACCAAAAATTGAACTGGG + Intronic
1007843561 6:44736025-44736047 CAGATACCATTACTGGAGATAGG - Intergenic
1013234238 6:108183018-108183040 CACCTATCATAACTGTTGTTTGG + Intronic
1014142345 6:117958469-117958491 AACCTACCATGAATGGAACTTGG - Intronic
1017750520 6:157486959-157486981 CACCTACCAATGCTGTAGCTGGG - Intronic
1019432438 7:1005523-1005545 CTCCTCCCATACTTGGAGCTGGG + Intronic
1021238912 7:18176971-18176993 TACATACCATAACTTGAGTTAGG + Intronic
1027446889 7:78284401-78284423 CACCTACCCTAATTGGTGTTTGG + Intronic
1027623263 7:80518777-80518799 CACCTATAATAACAGCAGCTTGG - Intronic
1031965051 7:128021803-128021825 CATCTGCCATAACAGGACCTAGG - Intronic
1036687140 8:10919136-10919158 GACCCAGCATGACTGGAGCTTGG - Intronic
1037421581 8:18708892-18708914 CACCTCCCTTGACTGGAGGTGGG - Intronic
1038480329 8:27897313-27897335 CTCCCAGCATAACGGGAGCTCGG + Intronic
1038856754 8:31341926-31341948 CACTTTCCATTACTGGAGATTGG + Intergenic
1042309036 8:67361849-67361871 CACCTATCATATGTGGAGGTAGG + Intergenic
1043061509 8:75510490-75510512 CACCTACCATGAAGGGAACTTGG - Intronic
1044244264 8:89923042-89923064 CGCTTACCATGAATGGAGCTTGG + Intronic
1044809925 8:96049396-96049418 CACCTTCAATAAATGGTGCTGGG + Intergenic
1048506296 8:135025326-135025348 CGTCTTCCATACCTGGAGCTGGG + Intergenic
1048562949 8:135562179-135562201 CACTTACCATGAGTGGAACTTGG - Intronic
1049639720 8:143709601-143709623 CATCTAACAGAACGGGAGCTGGG - Intronic
1052871058 9:33506960-33506982 CACATACCAAAACTGAAACTGGG + Intergenic
1057011289 9:91604002-91604024 CCCCTACCTTCTCTGGAGCTTGG + Intronic
1057116393 9:92526904-92526926 TACTTACCATGAATGGAGCTTGG - Intronic
1057687457 9:97248386-97248408 CACATACCAAAACTGAAACTGGG - Intergenic
1187777253 X:22775205-22775227 CACCTACCATACCGGTAGCTGGG - Intergenic
1189063326 X:37778213-37778235 CACTTACCATGAGTAGAGCTTGG + Intronic
1198782165 X:140249386-140249408 GACCTACCTTTACTGCAGCTAGG + Intergenic
1200248728 X:154540990-154541012 CACCTGCCATCAGTGGGGCTGGG + Intronic