ID: 933906147

View in Genome Browser
Species Human (GRCh38)
Location 2:86895223-86895245
Sequence CAAATTAGGACCCACCTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933906147_933906153 11 Left 933906147 2:86895223-86895245 CCATTTAGGTGGGTCCTAATTTG No data
Right 933906153 2:86895257-86895279 CTCACTGCTATTAAATGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933906147 Original CRISPR CAAATTAGGACCCACCTAAA TGG (reversed) Intergenic
No off target data available for this crispr