ID: 933914610

View in Genome Browser
Species Human (GRCh38)
Location 2:86976590-86976612
Sequence TTCTTGTTCTTCAGGAAAAA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 559
Summary {0: 2, 1: 6, 2: 2, 3: 55, 4: 494}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933914610_933914613 8 Left 933914610 2:86976590-86976612 CCGTTTTTCCTGAAGAACAAGAA 0: 2
1: 6
2: 2
3: 55
4: 494
Right 933914613 2:86976621-86976643 AAATTATCTGAGAAAGACCAGGG 0: 5
1: 3
2: 8
3: 23
4: 341
933914610_933914612 7 Left 933914610 2:86976590-86976612 CCGTTTTTCCTGAAGAACAAGAA 0: 2
1: 6
2: 2
3: 55
4: 494
Right 933914612 2:86976620-86976642 AAAATTATCTGAGAAAGACCAGG 0: 5
1: 0
2: 3
3: 42
4: 373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933914610 Original CRISPR TTCTTGTTCTTCAGGAAAAA CGG (reversed) Exonic
900699653 1:4037683-4037705 TTCATGTTCATCAGGAATATTGG - Intergenic
901760401 1:11467493-11467515 TTCAAGTCCTGCAGGAAAAATGG + Intergenic
905772514 1:40647490-40647512 TTCTTGTTCTGCAAAATAAAAGG - Intronic
906045344 1:42825817-42825839 TTCTTGTGCGTAAGGAGAAAGGG - Intronic
906547966 1:46635596-46635618 TACTTGATATTCAGGAACAAAGG - Exonic
906631742 1:47375586-47375608 AACTTGTTCTTCATGAGAAATGG + Intronic
907331358 1:53673723-53673745 TTCTTGTTCTAGAGAAAAATAGG - Intronic
907454091 1:54564231-54564253 TTCTTTTTCTTCTGGAGACAGGG - Intronic
908849641 1:68362855-68362877 TTGTTGTGTTTCAGGAAACAGGG + Intergenic
908925788 1:69253074-69253096 TTCATGTTCTGCAGAGAAAAAGG - Intergenic
909309588 1:74129629-74129651 TCCTTCTTCTCGAGGAAAAATGG - Intronic
909658677 1:78058775-78058797 TGTTTGTTATGCAGGAAAAAAGG - Intronic
910662058 1:89684474-89684496 TTCTTGTTTTTCAGGCAGTATGG + Intronic
911023776 1:93415127-93415149 TTTTTGTACTTCAGGCCAAAGGG - Intergenic
912281346 1:108317769-108317791 TTTTTGTTTCTTAGGAAAAAAGG + Intergenic
913358586 1:117952634-117952656 CTCTTATTCTTGAGGAAGAAAGG + Exonic
913419195 1:118645712-118645734 TTCATGTTCTCCAGGTAAACTGG - Intergenic
913970304 1:143410054-143410076 TTGTTGTTCTCCAGGAGAACAGG + Intergenic
914064679 1:144235668-144235690 TTGTTGTTCTCCAGGAGAACAGG + Intergenic
914114471 1:144730686-144730708 TTGTTGTTCTCCAGGAGAACAGG - Intergenic
915606688 1:156956421-156956443 TTCTTGGTCTTAGGGAAGAACGG + Exonic
915627173 1:157121915-157121937 TACCCATTCTTCAGGAAAAAAGG + Exonic
916258553 1:162816712-162816734 TAGTTGTTCTTCAGGAAGGATGG + Intergenic
916288319 1:163135414-163135436 TTTTTGTTCATCTGCAAAAATGG - Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918216143 1:182392793-182392815 TTCTTGTTAATCTGGAAAATGGG + Intergenic
918807890 1:189073075-189073097 TCTTTGTTCTGCAGGAAAAAAGG + Intergenic
918892844 1:190297611-190297633 TACCTGTTCTTCCAGAAAAAAGG - Intronic
918997956 1:191786856-191786878 TTTTTATTTTTCAGTAAAAAGGG + Intergenic
919116373 1:193285162-193285184 ATCTTGTGTTTCAAGAAAAATGG - Intergenic
919528404 1:198682815-198682837 TTCTTATTTTTCAGAAAAATGGG - Intronic
919656120 1:200198837-200198859 TACTAGTGCTTGAGGAAAAAAGG + Intergenic
921483105 1:215686296-215686318 TACTTGTTATTCAGAAGAAAGGG + Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921681306 1:218035348-218035370 TTCTTGTCCTTCAGATAATAAGG - Intergenic
921960826 1:221032672-221032694 TTCTTCTTATTAAGAAAAAAAGG + Intergenic
924264173 1:242264431-242264453 TTTTTCTTCTTCAGGAGGAAGGG + Intronic
924504464 1:244668531-244668553 TTCTAGTTTTTGAGGAGAAATGG + Intronic
1063703256 10:8406386-8406408 TCCTTGTTCTTGGGGAAAATGGG + Intergenic
1064262482 10:13797239-13797261 TTTCAGTCCTTCAGGAAAAAAGG - Intronic
1064914012 10:20436436-20436458 TTCTTGTTCTTTTGAAATAAAGG - Intergenic
1064961852 10:20973928-20973950 TGCTTGGTCTTCAGGAACAGTGG - Intronic
1065395571 10:25233210-25233232 TTATAGCTCTTCAGGAAAGAGGG + Intronic
1066543730 10:36476566-36476588 TTCTCTTTCTACCGGAAAAAGGG + Intergenic
1066720624 10:38334034-38334056 TTTTTCTTCTTCAGGAGGAAGGG - Intergenic
1066724998 10:38382394-38382416 TAGTTGTTCTTCAGGAAGGATGG + Intergenic
1067817629 10:49494526-49494548 ATCTGATTCTTCAGGAAAAAGGG - Intronic
1068205095 10:53840066-53840088 TCCTTGTTCTTAAGTACAAAAGG + Intronic
1068940898 10:62680136-62680158 TTTTTGTGTTTCAGGAAATAGGG + Intergenic
1069044962 10:63733624-63733646 TTCTTGTTCTGGAGGAAACTTGG + Intergenic
1069108967 10:64420471-64420493 TTCTTTTTCTCCAGGAATACTGG + Intergenic
1069288930 10:66752143-66752165 TTCTTTTTCTTTAAGAAAATTGG - Intronic
1070324474 10:75378915-75378937 TTCTTGTGGTTCAGGAATAAAGG - Intergenic
1070568007 10:77618583-77618605 TACTGGTTCTTCAGGAGAACAGG + Intronic
1070732373 10:78839695-78839717 TTCTTTTTTTTCAAGAGAAAAGG - Intergenic
1071521559 10:86334537-86334559 TTCTTCTACTTCAGGTAAAAAGG - Intronic
1073092089 10:100950732-100950754 TTCTTTTTCTTCTGGACAACGGG + Exonic
1074748673 10:116561772-116561794 TTCTGTTTCTTTAGGGAAAAGGG + Intronic
1075354521 10:121758966-121758988 TTGTTGTGTTTCAGGAAATAGGG - Intronic
1077448581 11:2618479-2618501 TTCGTGTTCTTGTGGAAAATTGG + Intronic
1077742747 11:4865282-4865304 TTCTTTTACATTAGGAAAAAAGG + Intronic
1078987819 11:16612252-16612274 TTTTTTTTTTTCAGGAACAAAGG - Intronic
1080119623 11:28662181-28662203 TTCTTATTTTTTATGAAAAAAGG + Intergenic
1080177298 11:29380330-29380352 TTTGTGTTCTTCAGGAAACTGGG - Intergenic
1081380134 11:42404607-42404629 TTATTTTTCTTTAGGAACAAGGG + Intergenic
1084011676 11:66353677-66353699 TTTTTGTGTTTCAGGAAATAGGG - Intronic
1084862836 11:72032371-72032393 TTCATTTTCTGCAGGTAAAATGG - Intronic
1085017120 11:73181493-73181515 TACTTGTTCTGCTGGAAAGAAGG + Intergenic
1085466684 11:76728745-76728767 TTTTTGTTCTTTAGGAGAGAGGG + Intergenic
1085648890 11:78249006-78249028 ATCATGTTCTTCATGAAAATGGG + Intronic
1087300572 11:96429175-96429197 TTCATTTTCCTCAGAAAAAAAGG - Intronic
1087483441 11:98731567-98731589 TACTTGCTCTTGAAGAAAAAGGG - Intergenic
1088806855 11:113360395-113360417 TTTTTTTTCTTATGGAAAAAAGG - Intronic
1088878743 11:113957397-113957419 GTCTTGTTCTCCAGAAAAGAGGG - Intergenic
1088936687 11:114408502-114408524 TTTTTGTTCTTCCTGAAAAGGGG - Exonic
1089442079 11:118525794-118525816 TTTTTGTTTTTAAGGAAAAGCGG + Exonic
1090324214 11:125870814-125870836 TAGTTGTTTTTAAGGAAAAAAGG + Intergenic
1090340155 11:126010911-126010933 TTCCTGTCCTTCAGAAAGAAAGG + Intronic
1090482185 11:127078479-127078501 ATCTTCATCGTCAGGAAAAAGGG + Intergenic
1090583749 11:128187809-128187831 TTCTTGTTCTACAGGCCAATAGG + Intergenic
1090604718 11:128409572-128409594 ATCTTGATCTCCAGGAAGAATGG + Intergenic
1091478900 12:806467-806489 TTCTTGTACTTCAGCAAAGTTGG + Intronic
1091526918 12:1312000-1312022 ATCATGTTCTTGAGGAAAAATGG - Intronic
1091875608 12:3930778-3930800 AGCTTCTTCTTCAGGAAAAAGGG + Intergenic
1093475284 12:19547852-19547874 TTCTGTTGCTTCAGGAAAAAAGG - Intronic
1093648426 12:21616056-21616078 TTCTTTTTTTTCAAGAAACAGGG + Intergenic
1094253359 12:28392846-28392868 TTCTACTTCTTCAGGTCAAAAGG - Intronic
1095537942 12:43274222-43274244 CTATAGTTCTTCAGGAAAATTGG - Intergenic
1095878553 12:47107492-47107514 TTCTGCTTCTTCTGGGAAAATGG - Intronic
1096417111 12:51424100-51424122 TTCTTTTTCTTGAGGAGAGAGGG + Intronic
1097396763 12:59084695-59084717 AAATTGTTCTTCAGGAAAGATGG - Intergenic
1097420703 12:59375352-59375374 ATTTTGTTCTTCAAGAAATAGGG - Intergenic
1097440974 12:59608384-59608406 TTCTTGTTCTGAAGTGAAAAAGG + Intronic
1097780587 12:63699335-63699357 TTCTCGTTCTGCTGGAAACAGGG - Intergenic
1097823177 12:64147982-64148004 TTCTTGTTCATTTGGAAATAGGG + Exonic
1097831114 12:64224704-64224726 TTTTTTTTCTTCAGGAAACAAGG - Intergenic
1098153355 12:67571586-67571608 TTCTTCTTCTTTTAGAAAAAGGG - Intergenic
1098855549 12:75649036-75649058 TCATTGTTCTTCTGGAAAACTGG - Intergenic
1099445758 12:82749663-82749685 TGCTAGTGCTTCAGGAACAAGGG + Intronic
1099593750 12:84629861-84629883 TTTTTGTTATTCGGGAAAGAGGG - Intergenic
1100839971 12:98602993-98603015 TACCTGTGCTGCAGGAAAAAAGG + Intronic
1103690442 12:122768893-122768915 TTGATGTCATTCAGGAAAAATGG + Exonic
1103856769 12:123975890-123975912 TTTATGTCCTTCAGGGAAAAGGG + Intronic
1104308518 12:127632824-127632846 TTCTTTTTCTACGGGAAAACAGG + Intergenic
1105520291 13:21125122-21125144 TTGTCATTCTTCAGGACAAAGGG - Intergenic
1105555113 13:21440106-21440128 TTCTTGTTCTTAGGAAATAAAGG + Intronic
1106100352 13:26689955-26689977 TTGTTGTTCATAGGGAAAAAGGG + Intergenic
1106495676 13:30272096-30272118 TTCTTGTAATTAAGAAAAAAGGG + Intronic
1107964456 13:45586741-45586763 TTCTTGTTCTACATGAACACAGG - Intronic
1108203813 13:48067962-48067984 ATCTTGTTTTGCTGGAAAAAGGG + Intronic
1108879778 13:55096759-55096781 TTCTTGTTCATGAGTAAACAAGG - Intergenic
1108890802 13:55256702-55256724 TTCTAGCCCTTCAGGAACAATGG - Intergenic
1109661063 13:65461444-65461466 TTTTTTTTTTTCAGGAAAAATGG - Intergenic
1109756488 13:66767720-66767742 TTTTATTACTTCAGGAAAAAAGG - Intronic
1110032864 13:70639026-70639048 TTCTTCTCCTTCGGGAAGAAGGG - Intergenic
1110411655 13:75210422-75210444 ATCTTGTTTCTCAGGAAATAAGG + Intergenic
1111645730 13:91029855-91029877 TTAGTGTTTGTCAGGAAAAAGGG - Intergenic
1111983267 13:95039402-95039424 TTCTTTTTGTACAGAAAAAAGGG + Intronic
1113125389 13:106972632-106972654 CACTTGTTGTTCAGGAAAAAGGG + Intergenic
1114537900 14:23434418-23434440 AACTAGTTCTTGAGGAAAAAGGG - Intronic
1115688511 14:35821329-35821351 TTCTTGTTCTAAAGGAAATATGG - Intergenic
1117040732 14:51766761-51766783 TTCCTCATCTTCAGGACAAACGG - Intergenic
1117084907 14:52189837-52189859 ATCTTGTTATCCAGGAAAAAGGG + Intergenic
1117134010 14:52715221-52715243 TTTGTGTTCTTCATGATAAAAGG + Intronic
1117307498 14:54490575-54490597 TCCTTATTCTTAAGGAGAAAGGG + Intergenic
1117581386 14:57155027-57155049 TTATTATTATTGAGGAAAAAAGG - Intergenic
1117955690 14:61121986-61122008 TTGTTTTTCTTCTGGAAAGAGGG + Intergenic
1118550421 14:66944043-66944065 ATCTTGTTTTTCTGGAAAAAGGG - Intronic
1119417413 14:74482326-74482348 CTCTTTTTCTTCATGGAAAAAGG + Intronic
1119470427 14:74894442-74894464 TTCGTGTTCTCTAAGAAAAAGGG - Intronic
1119588813 14:75865073-75865095 TTATTTTTCTCCAGTAAAAATGG - Intronic
1119896067 14:78220874-78220896 TTTTTTTTTTTCAGTAAAAAAGG + Intergenic
1120004833 14:79345044-79345066 TTCTTGTTCTTCGTGAATAGAGG - Intronic
1120309079 14:82807431-82807453 TTCTTATTTTTCAGGGGAAAAGG + Intergenic
1120689093 14:87572710-87572732 TGCTTGTTCTTCAGGTAATAAGG - Intergenic
1121293404 14:92795701-92795723 TTCTTGTTCTTGGGGAAAGTGGG - Intronic
1121388393 14:93551821-93551843 TCTTTATTCTTAAGGAAAAAGGG + Intronic
1121992883 14:98577050-98577072 TTCTTTTTCTTCAGGTAAATTGG + Intergenic
1123973333 15:25529076-25529098 AGCTTGATCTTCAGGAAAAATGG + Intergenic
1124142692 15:27091067-27091089 TTCCTGTTCTTAAGGGAGAAAGG + Intronic
1124801423 15:32836631-32836653 CTCTTGTTCTTCACCAAACAAGG - Intronic
1125519199 15:40338895-40338917 TCTTTGTTCTGCAGGAAAAGCGG - Exonic
1126370370 15:47939511-47939533 TTCTTATTCTTCAGTGAAATAGG + Intergenic
1126853057 15:52810145-52810167 TTTTTGTACTTAAGAAAAAATGG - Intergenic
1127029167 15:54842619-54842641 TTCTTGGTCTTTATGTAAAATGG - Intergenic
1127145389 15:56018185-56018207 CTCTTGCTCTTCAGGAGAGAAGG - Intergenic
1130342157 15:83008713-83008735 TTCTTTTTCTTCATGAAGCAAGG + Intronic
1131221447 15:90587944-90587966 CCCTTGTTCTTCAAGAAAATGGG + Intronic
1133726953 16:8546783-8546805 TTCTTTTTCTTCTGCAATAAAGG + Intergenic
1133995533 16:10745155-10745177 TTCTGGTTCCTCATCAAAAATGG + Intronic
1134280783 16:12815018-12815040 TTCTTATTCTTGTTGAAAAAGGG - Intergenic
1134516249 16:14889523-14889545 TTTTTTTTCTTCTGGAGAAAGGG - Intronic
1135050941 16:19192548-19192570 TCCTGTTTCTACAGGAAAAAGGG + Intronic
1135479191 16:22807320-22807342 TTGTTGTCCTTCAGGCAAAGGGG + Intergenic
1136359028 16:29765773-29765795 TTCCTTTGCTTCAGGAGAAAAGG - Intergenic
1137332447 16:47512320-47512342 TTCTTGGTCTTCAAGCAAAAAGG + Intronic
1137361425 16:47819733-47819755 TTATTGTTCTTCAGAAATATTGG - Intergenic
1137840631 16:51637509-51637531 ATCTTATCCTTCAGGCAAAATGG - Intergenic
1137968796 16:52962894-52962916 ATCATGTGCTTCAGGAAAAAGGG - Intergenic
1138160647 16:54750054-54750076 ATCTAGTTCTGCAAGAAAAATGG + Intergenic
1138749239 16:59398748-59398770 TTTTTGATCTACAGGAAACAAGG - Intergenic
1139396781 16:66646156-66646178 TTTTTGTTCTTCACCAAAAATGG - Intronic
1139865586 16:70059532-70059554 TTCTTTTTGTTCCGGAATAAAGG - Intergenic
1139973471 16:70790864-70790886 TTCTTCATCTCCAGGAAAACAGG + Intronic
1140189552 16:72803508-72803530 ATATTGTTCTGCAGGAAAATTGG - Intronic
1140403621 16:74692409-74692431 TTCATTATCTGCAGGAAAAAAGG + Exonic
1140896479 16:79329120-79329142 TTCTTGTTCTTCCTGGAGAACGG + Intergenic
1142404280 16:89878447-89878469 TTTTTTTTTTTTAGGAAAAATGG + Intronic
1143323782 17:6085022-6085044 CTCTGGTTCTTCTGGAAACAGGG - Intronic
1143368419 17:6423213-6423235 TTCTAGTACTGCAAGAAAAAAGG + Intronic
1143394024 17:6577589-6577611 TTTTTGTTCTTCATGAACAAGGG - Intergenic
1143793748 17:9319606-9319628 ATCTTGGTCTCCAGGGAAAAAGG + Intronic
1144511642 17:15882071-15882093 TTCGTGTCCTTAAGGAAAAGGGG + Intergenic
1146015334 17:29228592-29228614 TTCTTGTTTTTCAGTAGAGACGG + Intergenic
1147438819 17:40434515-40434537 TTTTTTTTTTTCAGTAAAAATGG + Intergenic
1147498606 17:40941175-40941197 TTCTATTTGTCCAGGAAAAAGGG - Intergenic
1148917954 17:50999767-50999789 CTCTTGTTCTTCAGAAAGAAAGG - Intronic
1149106526 17:52974065-52974087 TTCTAGTTCTTCATGAGAAATGG + Intergenic
1151767730 17:76140798-76140820 TTCCTGCTCTTCGGGAGAAAAGG - Intronic
1152891841 17:82886449-82886471 TTCTTGTTCATCATGAGGAAGGG + Intronic
1153083012 18:1250155-1250177 TTTTGGTTCTTCAAGAAGAAAGG - Intergenic
1153144888 18:2020023-2020045 TTCTTTTTCTTTAGGGGAAACGG + Intergenic
1153156307 18:2153427-2153449 TCCTTGTTCTGCATGAACAAGGG + Intergenic
1153235998 18:2988273-2988295 TTTATGCTCTTCAGGAGAAACGG + Intronic
1153585153 18:6613383-6613405 TTCTTGTTCTTCAAAACTAATGG + Intergenic
1153594299 18:6708949-6708971 CTCTTGTTTTTCAATAAAAAAGG - Intergenic
1154073310 18:11175562-11175584 TTCTTTCTCTTAGGGAAAAAGGG - Intergenic
1154157429 18:11954821-11954843 TTATTCTTCTTCCTGAAAAAGGG - Intergenic
1155109000 18:22695504-22695526 TTCTTATTCTTCAAAATAAAAGG - Intergenic
1155136196 18:22995145-22995167 TGACTGTGCTTCAGGAAAAAGGG - Intronic
1155318712 18:24597226-24597248 TTGTTCTTCTCTAGGAAAAAAGG + Intergenic
1155826192 18:30446351-30446373 TTATTGTTTTTGAGGATAAAGGG + Intergenic
1156071264 18:33213332-33213354 CTCTTCTTCTACAGGAAATAAGG + Intronic
1156796263 18:41050107-41050129 TGCTTTTTCTTCATGTAAAATGG - Intergenic
1157371410 18:47115928-47115950 ATCTTTTTCTTCAGGAAAGATGG - Intronic
1157781340 18:50442238-50442260 TTCTTGGTCTTCAGCCAAACAGG - Intergenic
1157842893 18:50976126-50976148 TTATTGTTCTACTGGGAAAAAGG + Intronic
1157851283 18:51053763-51053785 TGCTGGTTCTTAATGAAAAAGGG + Intronic
1157866746 18:51194636-51194658 ATCTTGTCCTTCAGTAAAACTGG + Intronic
1158246376 18:55437219-55437241 TTCTTGTATTAAAGGAAAAAGGG - Intronic
1159634437 18:70788281-70788303 TACTCATTCTTCAGGAAGAAAGG - Intergenic
1159792697 18:72802950-72802972 TGCTTGTTCTTAAGAAAAACAGG - Intronic
1160549448 18:79683978-79684000 TACTTATTTTTCAGGAATAACGG + Intronic
1161259594 19:3330022-3330044 TTTTTGTATTTCAGGAAAGACGG + Intergenic
1161357059 19:3825067-3825089 ATCTTGCTCTGCAGGAATAAGGG + Intronic
1162659145 19:12156146-12156168 ATTTAGTTTTTCAGGAAAAAAGG + Intronic
1164001373 19:21103227-21103249 TACTTTTTCTAAAGGAAAAATGG - Intronic
1164091978 19:21962494-21962516 TTCCTTTTCATCAGAAAAAAAGG - Intronic
1164109836 19:22145799-22145821 GTGTTGTGATTCAGGAAAAAAGG + Intergenic
1165988939 19:39794884-39794906 TTTTTTTTCTTCAGGAAATGAGG + Intergenic
1166526927 19:43516992-43517014 TTTTTTTTCTTCAGTAAAGATGG + Intronic
1166952210 19:46436872-46436894 TTTTTACTCTTCAGCAAAAAAGG - Intergenic
1168477834 19:56690348-56690370 TTCTTGTTTTCCAAGAAGAAAGG - Intergenic
925192642 2:1897959-1897981 TTCCTCTACTGCAGGAAAAAAGG + Intronic
926056061 2:9774736-9774758 GTTTTCTCCTTCAGGAAAAATGG + Intergenic
926500557 2:13648041-13648063 ATCTTGTTTTGCTGGAAAAAGGG - Intergenic
926678034 2:15642873-15642895 ATCTTGTCCTTCTGGAAAATGGG - Intergenic
926679435 2:15652639-15652661 TTTTTGTTAGTCAGGAAAACTGG - Intergenic
927457478 2:23267563-23267585 TTCTTATTCTTCAAAAGAAAAGG - Intergenic
928260105 2:29758725-29758747 TTCTTCTTCTTCAATTAAAAAGG + Intronic
928793339 2:34985522-34985544 AGCTTGTTTTTAAGGAAAAATGG + Intergenic
930278869 2:49345798-49345820 CTGTTGTTCTTCTGGAACAACGG + Intergenic
930733193 2:54748392-54748414 TTTTTCTTCTTCAGGCTAAAGGG + Intronic
930911994 2:56640327-56640349 TTCTTCTTCTTCACAAAATATGG + Intergenic
931372946 2:61681135-61681157 TTCCTGATCTTCAGTAAAACAGG + Intergenic
931614069 2:64137787-64137809 TCCTTGTTTTTAAGGAAAAAAGG - Intronic
931909842 2:66887137-66887159 TTCTTGTTAGCCAGGAAGAAGGG + Intergenic
932946894 2:76245118-76245140 TTTTTGTTTGTCAGGAAAATTGG + Intergenic
933289259 2:80419833-80419855 TGCTTGTTGTTCAGGAAAAATGG - Intronic
933386257 2:81614259-81614281 TTCTAGTTGATCAGGAAAAAGGG - Intergenic
933914610 2:86976590-86976612 TTCTTGTTCTTCAGGAAAAACGG - Exonic
934008383 2:87793309-87793331 TTCTTGTTCTTCAGGAAAAACGG + Exonic
934174998 2:89570978-89571000 TTGTTGTTCTCCAGGAGAACAGG + Intergenic
934285314 2:91645332-91645354 TTGTTGTTCTCCAGGAGAACAGG + Intergenic
934965807 2:98720908-98720930 TTATTGTTCTTCAGTAAATTTGG - Intronic
935090055 2:99886421-99886443 TTTTTTTTTTTCAGGAATAAAGG + Intronic
935351846 2:102157707-102157729 TTCATATTCTTCTGGAGAAATGG - Exonic
935380969 2:102450834-102450856 TTCCTATTCTTCAGATAAAAAGG + Exonic
935426270 2:102921307-102921329 TTCTTCTTCTTAATGAAGAAAGG + Intergenic
935718393 2:105958897-105958919 TTCTTCTTCTTCTGGATACAGGG + Intergenic
935743800 2:106173934-106173956 TTCTTGTCCTTGAAGGAAAATGG + Intronic
935754868 2:106269319-106269341 TTTTTGTTTTTCAGTAGAAACGG - Intergenic
935772030 2:106434315-106434337 TTCTTGTTCTTCAGGAGAAAGGG + Exonic
935908039 2:107861631-107861653 TTCTTGTTCTTCAGGAGAAAGGG - Exonic
935994447 2:108753862-108753884 TTCTTGTTCTTCAGGAGAAAGGG - Exonic
936129830 2:109826738-109826760 TTCTTGTTCTTCAGGAGAAAGGG - Exonic
936214867 2:110544747-110544769 TTCTTGTTCTTCAGGAGAAAGGG + Exonic
936424004 2:112399310-112399332 TTCTTGTTCTTCAGGAGAAAGGG + Exonic
936856374 2:116962709-116962731 TTCCTGTTCTGCTGGAGAAAGGG + Intergenic
937275380 2:120680721-120680743 TGCTTGTTCATCTGGAAAATGGG + Intergenic
937535334 2:122879629-122879651 TTCTAAATCTTCAGGAAATATGG - Intergenic
938870890 2:135475045-135475067 TGCTTGTTCTGCAGACAAAAGGG + Intronic
938901738 2:135804261-135804283 TTCTTTTTCTTTTGGGAAAAGGG + Intronic
939353066 2:141066001-141066023 TTTTTGTTATGCAGCAAAAAGGG + Intronic
940293666 2:152100635-152100657 TTCTTGTGCTTCTGAAAAACTGG + Intergenic
940564809 2:155347951-155347973 TTTTTGTTCATCAGGAATATAGG + Intergenic
940927886 2:159387634-159387656 TTCCTGTGGTTCAAGAAAAAGGG - Intronic
941002134 2:160213353-160213375 TTCTTTTTCTTCTGTAAAATGGG - Intronic
941201354 2:162514751-162514773 TTCTGGTTCTTCATCAAAGATGG + Intronic
941571945 2:167181628-167181650 TATTTGTTCTGGAGGAAAAAAGG - Intronic
941842457 2:170101037-170101059 TTTTTGTTATTCAGCACAAAAGG + Intergenic
943591084 2:189797679-189797701 TACTTGTTGTTCTGGAAAAGTGG + Intronic
944410138 2:199432586-199432608 TTCTTGTTTTTCAGCTGAAATGG - Intronic
944630949 2:201623450-201623472 TTCTTGTCACTCAGAAAAAAGGG + Exonic
944824945 2:203473341-203473363 TCCTTGCTCTTCAGAAAAAAGGG + Intronic
945655944 2:212624261-212624283 TTTTTTTTAATCAGGAAAAAAGG + Intergenic
945674464 2:212839253-212839275 TTGTTGTGCTTCAGAGAAAATGG + Intergenic
946588078 2:221213031-221213053 TTCTCCTTCCTAAGGAAAAAGGG + Intergenic
946899470 2:224358207-224358229 TACTTTTTCTTAAAGAAAAATGG - Intergenic
947168866 2:227290742-227290764 TTCAGGTTCTAAAGGAAAAAGGG + Exonic
947437831 2:230088110-230088132 TTCTATTTCTTCAGGAACCATGG + Intergenic
947831773 2:233146500-233146522 TTCTTGTTCCTGTGGAAAGAGGG + Intronic
947996621 2:234533474-234533496 ATCTTTTTCTTCAGAAAGAAAGG + Intergenic
1169968721 20:11246082-11246104 TTATTGTTATTAAAGAAAAATGG + Intergenic
1170559818 20:17547288-17547310 TTCTTATTCTTAAGGAGACAGGG + Intronic
1173136338 20:40442504-40442526 TTTATTTTCTTCTGGAAAAAAGG - Intergenic
1173585364 20:44178192-44178214 TTTTTGTTTTTCAGGTGAAAAGG - Intronic
1173755271 20:45510283-45510305 TTCTTTTTCTTAAGGTAAATCGG + Intergenic
1174103114 20:48142319-48142341 TTTTTGTTCCTCATGAAAAAAGG - Intergenic
1174585827 20:51607446-51607468 TTCTTGTTCTACAGGCAAGAAGG + Intronic
1174753334 20:53133958-53133980 TTTTTTTTTTTCAGAAAAAATGG - Intronic
1174770045 20:53291089-53291111 TTCATGTTCTTGAGGAGACATGG - Intronic
1175291780 20:57880829-57880851 TTCATGTTCATGAAGAAAAAAGG - Intergenic
1175522297 20:59609568-59609590 TTCCTGTTCTGCAGGAAAACCGG - Intronic
1176273802 20:64251997-64252019 TTCCTGATCTTAAGGAGAAAGGG + Intergenic
1177391470 21:20478980-20479002 TTGTGGTTCATCAAGAAAAATGG + Intergenic
1177897286 21:26868833-26868855 TTCTTGTTATACTGGTAAAATGG + Intergenic
1178026166 21:28470451-28470473 GTCTTGTTCATCAGGAATATTGG - Intergenic
1178027154 21:28481000-28481022 AACTTGTTTTTAAGGAAAAAAGG - Intergenic
1178047754 21:28713959-28713981 TACTTGTTCATCAGGAATAATGG + Intergenic
1178117518 21:29432614-29432636 TCCTTCTTCTGCAGGAAAGAAGG - Intronic
1179047968 21:37863587-37863609 TTTTTGTGCATCAGGAAATAAGG + Intronic
1179473300 21:41626453-41626475 TTCTTTTTCTTAAGGCAACATGG + Intergenic
1180208719 21:46280101-46280123 TTCTTCTCCTTCAGGGAAAAGGG + Exonic
1180244784 21:46539699-46539721 TTCATGTTCTTCAAGGAAGATGG - Intronic
1181847563 22:25724301-25724323 TTCTAGATCTCCAGGATAAAGGG + Exonic
1182498942 22:30731680-30731702 TTTTTGTTCTCCAAGGAAAACGG - Intronic
1183392322 22:37552535-37552557 TTCTTGCTCTCCAGGAGAAAGGG + Intergenic
1183956670 22:41384490-41384512 TTCTGCTTATTCAGGAATAAAGG + Intronic
949123880 3:421819-421841 TTCTGGCCCTTCAGGAAAACTGG - Intergenic
949249020 3:1960337-1960359 TTGTTGTTATTCAGACAAAAAGG - Intergenic
949540777 3:5030640-5030662 TTCTTTTTTTTCTGGAAAGATGG - Intergenic
950396456 3:12737746-12737768 CTCTTGTTCTTAAGGAGAAGTGG - Exonic
950573882 3:13819227-13819249 TTCTTGATCTTCAGGAAGGTGGG + Exonic
950589892 3:13929604-13929626 TTCTTGTCCTTCAGGAAGCAGGG + Intergenic
951073247 3:18357944-18357966 TTATGATTCTTCATGAAAAAAGG - Intronic
951800863 3:26594902-26594924 TTATTGTTCTTCAAAAGAAAGGG - Intergenic
952294711 3:32051069-32051091 CTCTTGTTTTTCTGGAAAAGAGG + Intronic
952555433 3:34524749-34524771 ATTTTCTTCTTCAGGAAAATAGG - Intergenic
955113705 3:55975472-55975494 GCCTTGTTCTTCTGGAAACAAGG + Intronic
956295504 3:67708754-67708776 TTTTTGTTCTTCAGTACATAGGG - Intergenic
956518935 3:70082515-70082537 TTCATTTTCCTAAGGAAAAAAGG - Intergenic
957518657 3:81290068-81290090 TTGTTGTGTTTCAGGGAAAAGGG + Intergenic
957769387 3:84670267-84670289 TTATTTTTCTTCATGAAAGAAGG + Intergenic
957959858 3:87235666-87235688 TACTTGTTTTTCAGTAAAGATGG + Intronic
957970584 3:87376656-87376678 TTCTGGTTCTTCAGTAAAGAAGG + Intergenic
957978800 3:87481265-87481287 TTCTTCTTTTCTAGGAAAAAGGG + Intergenic
958507117 3:94993885-94993907 TTCTTGTACTTAAAAAAAAAAGG + Intergenic
958633902 3:96717745-96717767 ATCTTGTTTTTAAGAAAAAAGGG - Intergenic
959165932 3:102778122-102778144 TTCCTGTACTTCTAGAAAAAAGG + Intergenic
960191606 3:114713224-114713246 TTCATTTTCTTCAGAAGAAAAGG + Intronic
960386730 3:117029504-117029526 AACTTGTTTTTCTGGAAAAAAGG + Intronic
960781150 3:121319446-121319468 TTCTTATTCTTCAGGAATCTAGG + Intronic
960872057 3:122260041-122260063 GTTTCGTTCTTCAGAAAAAATGG + Intronic
961067354 3:123886956-123886978 TTCTGGTTCTCAAGGACAAAAGG + Intergenic
961127132 3:124429821-124429843 TTCTGGATCATCAGGAAAAGGGG - Intronic
962174216 3:133135911-133135933 TTTATGTGCTTCAGGACAAATGG + Intronic
962402785 3:135075587-135075609 TTGTGCTTCTTCAGGAATAAGGG + Intronic
962580692 3:136795292-136795314 TTCCTCTTCTCCAGGCAAAAGGG - Intergenic
963143239 3:141965483-141965505 TTCTTTTTCTTCTTGAGAAAGGG - Intronic
963949716 3:151185554-151185576 CTTTTGCTCTTGAGGAAAAAAGG + Intronic
964211279 3:154231112-154231134 TTCATGTGTTTCAGGAACAAAGG - Intronic
964345985 3:155755245-155755267 TTATTATACTTCTGGAAAAAAGG - Intergenic
964737321 3:159930043-159930065 CTCTTGCTGTTCAGGAACAAGGG + Intergenic
965433368 3:168616822-168616844 TTCTCATTCTTCATGAGAAATGG + Intergenic
965448742 3:168809897-168809919 ATCTTGTTCTTCAGGAGCAATGG + Intergenic
965948055 3:174266869-174266891 TTCATTTTTTTCAGTAAAAATGG + Intronic
966097239 3:176218829-176218851 TACATGTTCATCAGGAAACATGG + Intergenic
966465742 3:180229137-180229159 ATCTTGTTTTTCTGGAAAAGAGG + Intergenic
967470101 3:189851388-189851410 TTCTTTTTCTTCAGCAGAGACGG - Intronic
967836992 3:193973146-193973168 TTCTTGTTCTGTAGGATGAAGGG - Intergenic
967856723 3:194123349-194123371 TTCTTCTTTTTCAGGGAAAAGGG - Intergenic
967962112 3:194933755-194933777 TTCTGGTTCTGCAGGAAAACAGG - Intergenic
967966379 3:194963413-194963435 ATTTGGTTCTTCAGTAAAAAAGG - Intergenic
968314213 3:197709225-197709247 TTCCTGTTCTTATCGAAAAATGG + Intronic
968397262 4:252932-252954 TTCATGTTTTTCAGTTAAAAGGG + Intergenic
968402600 4:311589-311611 TTTGTGTTCTTGAGGACAAAGGG + Intergenic
969869070 4:10093575-10093597 TCCTTGTTCTCCAGGGAACATGG - Intronic
970200277 4:13597720-13597742 TTTCACTTCTTCAGGAAAAAAGG + Intronic
970419968 4:15896812-15896834 TTTTTTTTTTTCAGGAGAAAAGG - Intergenic
971187078 4:24389000-24389022 TTCTTTGTTTTCAGGAAAATTGG - Intergenic
971325411 4:25639435-25639457 TGCTTCTGCTACAGGAAAAAAGG + Intergenic
972097194 4:35363357-35363379 TTGGTGTTCTTGAGGAAAAAGGG - Intergenic
972925408 4:43999634-43999656 TGCTTGTGGTACAGGAAAAAGGG + Intergenic
973868885 4:55144360-55144382 TTCGTGTTCATTAGGAAATAAGG + Intergenic
974602589 4:64104818-64104840 TTATGTTGCTTCAGGAAAAAGGG - Intergenic
974981452 4:68962358-68962380 TTTTTTTTCTTCAGTAAAAATGG + Intergenic
975788221 4:77917675-77917697 GTATTTTTCTTGAGGAAAAAAGG - Intronic
975788438 4:77920694-77920716 TTCTTCTTCTAAAGGAAGAAGGG + Intronic
976443859 4:85108138-85108160 TTCATGTCCTTCTGGAAAGAGGG + Intergenic
976938696 4:90672809-90672831 TTGTTGTGTTTCAGGAAATAGGG + Intronic
978036010 4:103995766-103995788 TTCTTATTTTTCAGTAAAAATGG - Intergenic
978165196 4:105598603-105598625 ATCTTATTCTTCATGAAAATCGG - Intronic
978386797 4:108184250-108184272 TTTTTTTTCTTCAATAAAAAAGG - Intergenic
978418113 4:108500644-108500666 TACTTGTTATGCATGAAAAAAGG + Intergenic
978516959 4:109578878-109578900 TTTTTGTTCTCCAGGAATTAAGG - Intronic
978547386 4:109886265-109886287 TTCTCTTTCTTCTGGACAAATGG + Intergenic
978793370 4:112685273-112685295 TTCTTGGTCTACAGGGTAAATGG + Intergenic
978895674 4:113884765-113884787 TTCTTTGTTTTCAGGAACAAAGG - Intergenic
979023625 4:115538288-115538310 TGCTTCTTCTGAAGGAAAAAAGG - Intergenic
979170398 4:117594855-117594877 TTTTTTTTTTTCTGGAAAAAAGG - Intergenic
979302703 4:119105816-119105838 TTCCTGTCATTCAGGAAGAAGGG + Intergenic
979393660 4:120159389-120159411 TACTTTTTCTCCAGGAAAAAGGG - Intergenic
979809954 4:125025035-125025057 TTCTTGTTATTAAAAAAAAATGG + Intergenic
980184995 4:129449774-129449796 TTGATGTTCATCAGGAATAATGG - Intergenic
981233576 4:142388362-142388384 ATCTTATTTTTCTGGAAAAAGGG + Intronic
981798514 4:148628363-148628385 GTCTTATTCATCAGGAAAAATGG + Intergenic
983264304 4:165491728-165491750 TTCTTTTTTTTTAAGAAAAATGG + Intronic
983812404 4:172078735-172078757 TTCTTGTCTTTGAGGGAAAAGGG + Intronic
984006990 4:174323860-174323882 TGCTTGTTTTTCAGGAAATTAGG - Intronic
984658607 4:182348058-182348080 TTCTTTCTATTCATGAAAAAAGG + Intronic
985622619 5:963377-963399 TTCTTATTCTTCTGGAATTAGGG + Intergenic
986840852 5:11695569-11695591 TTCTATTTCTTGAGAAAAAATGG + Intronic
987394126 5:17405342-17405364 TTCTTGTTCTCCAAGAAATATGG + Intergenic
988087818 5:26494514-26494536 TTCTTGTGATACAGGAAAGAAGG + Intergenic
988420121 5:30995335-30995357 TTCTTCTTTTTCATCAAAAAGGG - Intergenic
988443277 5:31256579-31256601 TTTTTGTTTTTCAGTAATAAAGG + Intronic
988824245 5:34918350-34918372 TTCTTTTTCTTTAGGGAAAGTGG + Exonic
988882746 5:35521166-35521188 TTCTTGATGTTCAGGGAAACTGG + Intergenic
988931001 5:36035569-36035591 TTCCTGTTCTTCAAGAAAACAGG + Exonic
989201078 5:38764433-38764455 TTCTAGTTCTTCTGGACACATGG + Intergenic
989691981 5:44155231-44155253 ATCTTGTTTTGCTGGAAAAAGGG + Intergenic
989993234 5:50794651-50794673 TTTTTGCTTTTCAGGAAAAATGG + Intronic
990205481 5:53424550-53424572 TTCTTTTTCTTAAGACAAAAAGG + Intergenic
991133387 5:63152904-63152926 TGCTTGTATTTCAGGGAAAAAGG + Intergenic
992414915 5:76543220-76543242 TTCTTGAGTTTCAGGAAATATGG - Intronic
992833043 5:80614201-80614223 TTCCTGCTTTTCAGTAAAAAAGG - Intergenic
993255912 5:85589944-85589966 TTCTTCTTCTTCTGTAGAAAGGG - Intergenic
993782019 5:92077838-92077860 TTCTTGTTCCTGAGAGAAAAGGG - Intergenic
994280130 5:97891813-97891835 TTCTTTTTCTCCAGTTAAAACGG - Intergenic
994303210 5:98171783-98171805 TTCTTGCTCTACAGGAAATCTGG + Intergenic
996365726 5:122698922-122698944 TTTTTGTTATACGGGAAAAAGGG - Intergenic
996685212 5:126272456-126272478 TTTTTCATCTTCAGGAAGAAAGG + Intergenic
997473154 5:134127908-134127930 ATTTTGTTCTTAAGTAAAAAAGG + Intronic
997680159 5:135744642-135744664 TTCTGGTTCCTCATCAAAAATGG - Intergenic
997852107 5:137342265-137342287 TTCTTGTTCTGAAGGAAACCTGG - Intronic
997918842 5:137957724-137957746 TACTTGTTCTTCCAGAAATAGGG - Intronic
997989833 5:138535257-138535279 TTCTTCTTCTTCTTTAAAAAAGG - Intronic
998172902 5:139882890-139882912 TTCTTGTTCCTCAGAAGGAAGGG - Intronic
998686871 5:144536934-144536956 TTCTTTTTCTTTAAAAAAAATGG - Intergenic
999635412 5:153616749-153616771 TTCTTGGGCATCAGGGAAAAGGG + Intronic
1000851852 5:166350028-166350050 TTCTTCTTCTTCAAGAAAAAAGG - Intergenic
1000977950 5:167785465-167785487 TTCTAGTCCTGCAGGAAAAGGGG + Intronic
1001036870 5:168303285-168303307 TTCTTGTTCATTAAGAAATAAGG + Intronic
1001143475 5:169164363-169164385 TGCTGCTTCTTCAGGAAAAGGGG - Intronic
1001813489 5:174648389-174648411 TCTTTGTTCTGCAGAAAAAAGGG + Intergenic
1002400822 5:178990855-178990877 TCCTTGTTTCTCAGGAAAAACGG + Intronic
1003117310 6:3291608-3291630 TTATTTTTCCTCAGCAAAAATGG + Intronic
1003639866 6:7867597-7867619 TTCTAGTTCTCCAGGAAAGTTGG + Intronic
1004405230 6:15326986-15327008 TTGTTGTTCTTGAGGAAATGAGG + Intronic
1004415659 6:15421973-15421995 TTCATGTACTTCAGAAAAGAAGG - Intronic
1005361657 6:25036802-25036824 CTCCTGTTCTTCTGGGAAAATGG - Intronic
1005655442 6:27930685-27930707 TTCTTATTCTTTATGAAAAATGG + Intergenic
1006822377 6:36907773-36907795 GTCTGGTGCTTCAGGAAAAGTGG + Intronic
1008026490 6:46642233-46642255 TCCTTCTTCTTCAGTAACAAAGG + Exonic
1008138894 6:47809088-47809110 TTTTGGGTCTTTAGGAAAAATGG - Intronic
1008285700 6:49646833-49646855 TTCTTTTTCTTCAGCTAAATTGG + Intergenic
1008604491 6:53127294-53127316 TTCTTTGTCTTTATGAAAAATGG + Exonic
1008865207 6:56202270-56202292 TTGTTTTTCTGGAGGAAAAAGGG + Intronic
1009488953 6:64262910-64262932 TCTTTATTCTTCAGGAAAAAGGG + Intronic
1009634339 6:66245531-66245553 ATCTTTTTCTTCAGTAAACAAGG + Intergenic
1009919902 6:70044592-70044614 TTGTTGTTCCTTAGGAAATAGGG + Intronic
1010260892 6:73815701-73815723 ATCTTGTTAATAAGGAAAAAGGG + Intronic
1010452862 6:76022052-76022074 TTTTTGTTCTTTAGCAAAACAGG - Intronic
1010595531 6:77758425-77758447 CTCTTGTCCTTCAGAAAAAAAGG - Intronic
1010903530 6:81457100-81457122 TTCTTAGTCTTCACAAAAAAAGG - Intergenic
1010907181 6:81505375-81505397 TTCTTAATCTCCAGGCAAAAGGG - Intronic
1011718273 6:90129331-90129353 TTCTTTTTCTTCTAAAAAAACGG + Intronic
1011759084 6:90540094-90540116 TTCAGGTTCTTCAGGAAACTAGG + Intronic
1011767446 6:90638159-90638181 TTATTTTTCTTCAAGAAATAAGG + Intergenic
1011988929 6:93487628-93487650 TTCTTGTTTTTAAGCCAAAAGGG - Intergenic
1012009277 6:93760406-93760428 TTTTTTTTTTTCAGGAAAAGTGG - Intergenic
1012686697 6:102259412-102259434 TTCATATTCCTCAGGTAAAATGG + Intergenic
1012896477 6:104955380-104955402 TTGTTATTTCTCAGGAAAAAGGG - Intergenic
1013081879 6:106820448-106820470 TCCTTCTTCTTAAGGAAAAAGGG - Intergenic
1013535592 6:111060504-111060526 TTGTTGTTTTTTAGGAAACAGGG - Intergenic
1014403517 6:121020403-121020425 TTCTTTGTCTTCTAGAAAAACGG - Intergenic
1015618665 6:135106516-135106538 TTCTTGTTCTTCCTGGAACAAGG - Intergenic
1015645405 6:135382001-135382023 TTCTGGTTCTTCTCAAAAAAAGG + Intronic
1015871122 6:137777418-137777440 TTTTTTTTCTTCAGTACAAACGG - Intergenic
1016495314 6:144654920-144654942 TTTTTCTTCTTCAGGAAAATGGG - Intronic
1018231672 6:161681844-161681866 TTCTCGTTCTTCATGCCAAAGGG + Intronic
1018330420 6:162721570-162721592 TACTTGTCCTGCAGGAAAACTGG + Intronic
1018801905 6:167229356-167229378 ATCTTGTTTTTCTGGAAAAAAGG + Intergenic
1018849501 6:167576828-167576850 ATCTTGTTCTTCAGGAATTTGGG - Intergenic
1018934569 6:168265354-168265376 TTCTCTGCCTTCAGGAAAAAGGG - Intergenic
1019377559 7:701768-701790 TCCTTGTCCTTCAGGAATGAAGG + Intronic
1020626188 7:10582459-10582481 TTCTTGTGCCTCAGGGAATAGGG - Intergenic
1021453061 7:20799247-20799269 TTCTGGCTCTTCAGGGGAAATGG - Intergenic
1021526432 7:21593728-21593750 TACTATTTCTTAAGGAAAAAAGG + Intronic
1022050859 7:26669649-26669671 TTCCTTTTCTGCAGGAGAAAGGG + Exonic
1022412785 7:30152276-30152298 TTCTTGACCCTAAGGAAAAAAGG - Intronic
1022939172 7:35215387-35215409 TTCTCGTTCTGCTGGAAACAGGG - Intronic
1027447229 7:78288465-78288487 TTTTAATTCTTCAGGAAATACGG + Intronic
1027700876 7:81468890-81468912 CTCTCTTGCTTCAGGAAAAAAGG + Intergenic
1028441242 7:90864118-90864140 TTTTTTTTTTTAAGGAAAAATGG - Intronic
1028801056 7:94966742-94966764 TTGATGTTCTTCAGGAATATTGG + Intronic
1029301062 7:99582682-99582704 TTCTTAATATCCAGGAAAAAAGG - Intronic
1030682505 7:112448945-112448967 TTCTTGTTCTTCAGCCAAACAGG - Intronic
1030996553 7:116366257-116366279 TTCTTGATCTTCTACAAAAAGGG - Intronic
1031205604 7:118753548-118753570 TTCTTGTTGTTAGGGAACAAGGG - Intergenic
1031514216 7:122682249-122682271 TTGTTGTTCATCATGGAAAAGGG + Intronic
1032354803 7:131200725-131200747 CTTTAGTTTTTCAGGAAAAATGG - Intronic
1032834585 7:135661562-135661584 TTCTTGTTTTTCAGGAAGTTGGG + Intergenic
1032889222 7:136176501-136176523 TTCTGCTTTTTCAGGATAAAAGG - Intergenic
1033789346 7:144772567-144772589 TGTTTGGACTTCAGGAAAAAAGG + Intronic
1034036888 7:147834157-147834179 TTCTTGCACTACAAGAAAAAGGG - Intronic
1034145285 7:148865600-148865622 TTCTCATTCTAGAGGAAAAATGG + Intronic
1035191836 7:157176579-157176601 TTCTTGTTGTTAAAGAAACATGG - Intronic
1035859372 8:3011131-3011153 TTCTTGTTCCTCAAGAACTATGG - Intronic
1036394961 8:8361616-8361638 TTCTTGTGATGCAGGAAAATTGG + Intronic
1036456904 8:8917478-8917500 TTCTTGCTCATTATGAAAAAAGG - Intergenic
1038167324 8:25098492-25098514 TTCTTGTTCTTCCTGGACAAAGG - Intergenic
1038177331 8:25193018-25193040 TGCTTTTTCTTCATTAAAAAAGG + Intronic
1038335862 8:26644954-26644976 TCCTTATTCTTCTGGAAATAAGG - Intronic
1041656680 8:60358817-60358839 AAATTGTTCTTCAGGGAAAATGG - Intergenic
1043050121 8:75376184-75376206 GCCTTGTTTTTGAGGAAAAATGG + Intergenic
1043319386 8:78963539-78963561 TTCTTGATCTACAAGAATAATGG + Intergenic
1044638772 8:94356099-94356121 TTCTTTTTCTTTAAGAAACAAGG - Intergenic
1045577849 8:103445220-103445242 TTGTGGTCCTTCAGGGAAAAGGG - Intergenic
1046158616 8:110329502-110329524 TTCTTCTTGTGTAGGAAAAAAGG - Intergenic
1047059789 8:121212444-121212466 TTCCTGTTCTTAAAGAAACATGG - Intergenic
1047108743 8:121764908-121764930 TCCCTGTTCTTCAGAAAAATGGG + Intergenic
1047619088 8:126588044-126588066 TTCTTCTTCTTTTTGAAAAAAGG - Intergenic
1049715895 8:144091630-144091652 TTCATGTTTTTCATGAAACATGG + Intergenic
1049949408 9:629921-629943 TGCTTGTTTTTCAAGAACAAAGG + Intronic
1050100298 9:2111989-2112011 TTCTAAGTCTTCAGGAAATATGG + Intronic
1050716834 9:8538313-8538335 TTCTTGTTTTTTAGAAAAAGAGG + Intronic
1050783045 9:9363356-9363378 ATTTTGTTCTTCAGGTATAAGGG - Intronic
1050879237 9:10678412-10678434 GTCTCATTCTTCAGGAAATAGGG + Intergenic
1050993841 9:12188220-12188242 TTTTTTTTCTTTAGAAAAAATGG - Intergenic
1051534990 9:18147328-18147350 TTTTAGTTAATCAGGAAAAAAGG + Intergenic
1051586708 9:18734326-18734348 TGTCTTTTCTTCAGGAAAAAAGG - Intronic
1051966671 9:22836349-22836371 TGCTGGTTCTTCAGGGAAAAAGG + Intergenic
1057013438 9:91629233-91629255 TTATTGTTTTTCAGTAAATATGG + Intronic
1057515548 9:95717399-95717421 TTCTTGTTCTTCATGATATGGGG - Intergenic
1057617973 9:96609422-96609444 TTCTCAGTCTTCAGGGAAAAGGG + Intronic
1057645460 9:96870430-96870452 TTCTAGTTCTTCAGCAGGAAAGG - Intronic
1057757518 9:97849717-97849739 GTTTTGTTGTTCAGTAAAAAGGG + Intergenic
1058052682 9:100422525-100422547 TTCTTTTTCTTTTTGAAAAAGGG + Intergenic
1058632257 9:107001211-107001233 TGCTAGTTTTTCAGGAAAAGTGG - Intronic
1058851431 9:109014822-109014844 TTCTTTTTCTTCATTCAAAAAGG + Intergenic
1059331649 9:113539283-113539305 TGCTTGCTCTTCAGGTATAAGGG + Intronic
1059621360 9:116009110-116009132 ATTTTTTTCTTCAGGAAAATAGG + Intergenic
1060459590 9:123837706-123837728 TTCCTTTTCTTTAGGAAAAGAGG - Intronic
1060649743 9:125315116-125315138 TGCTTGTTATTCAAGAAAATGGG + Intronic
1060905379 9:127300141-127300163 TTGATGTTATTCAGGAAAACTGG - Intronic
1061378002 9:130237407-130237429 TTCTTTCTCTTCAGGAAACTGGG - Intergenic
1061704091 9:132439243-132439265 GTCTTGTTCTTCAGGACTCAGGG - Intronic
1185895742 X:3857415-3857437 TTTTTGTACTTCAGTAAAGATGG + Intergenic
1185900861 X:3895839-3895861 TTTTTGTACTTCAGTAAAGATGG + Intergenic
1185905976 X:3934278-3934300 TTTTTGTACTTCAGTAAAGATGG + Intergenic
1187419768 X:19123519-19123541 TTCTAGTTGTAAAGGAAAAATGG - Intergenic
1187541320 X:20198580-20198602 TTCTTGTTCTTGTTTAAAAAGGG + Intronic
1187689173 X:21847092-21847114 TTCTTGTTCAACAAGAAAGAGGG + Intronic
1187742741 X:22373899-22373921 TTCCTGTTCTTGAGTAAACATGG - Intergenic
1187747815 X:22428903-22428925 TTTTAGTTATTCAGGCAAAATGG - Intergenic
1188058985 X:25577144-25577166 TTCTTGTTCTTCCTCAAACATGG + Intergenic
1188574041 X:31624261-31624283 TCCTTGTACTTCAGGATAAGGGG - Intronic
1188625080 X:32274225-32274247 TTCTTGTTCTTCAGTATATGAGG - Intronic
1189298872 X:39937829-39937851 TCCTTATTGTTCAGGAACAAAGG - Intergenic
1189670817 X:43407031-43407053 TTCATTTTTTTAAGGAAAAATGG + Intergenic
1189716096 X:43867969-43867991 TACTTTTTCTTAGGGAAAAAAGG - Intronic
1190700164 X:52981827-52981849 TTTTTTTTTTTCAGGAAAAGGGG + Intronic
1192469942 X:71389607-71389629 TTCTTCTTCTGGAGCAAAAAAGG - Exonic
1192966193 X:76179717-76179739 TTGATGTTCTTCAGGAATATTGG + Intergenic
1194340172 X:92697430-92697452 TACTTGTTCTTCAGGTCAGAAGG + Intergenic
1194618182 X:96133622-96133644 TTGTTGTTCTTCAGTGAATAGGG - Intergenic
1194665139 X:96669389-96669411 TTCTTGGTTATCAGGAAAAATGG - Intergenic
1194933299 X:99915788-99915810 TTCTGATTCTTAAGAAAAAAAGG - Intergenic
1195100566 X:101551134-101551156 TTTTTTTTCTTCAGTAAAAGAGG + Intronic
1195543488 X:106088812-106088834 TTTTGGTTTTTCAGGAAAAGGGG - Intergenic
1195619942 X:106942902-106942924 TTCTAATTCTTCAGGAAGCAGGG + Exonic
1196161456 X:112488515-112488537 TTGTTGTTCCTGAGGAAGAAGGG + Intergenic
1196226611 X:113176026-113176048 TTCTTGTTTTTTTGGAAAACAGG - Intergenic
1196281639 X:113829521-113829543 TTCTTGTGATTCAGGGAACATGG + Intergenic
1196991813 X:121337618-121337640 TTCTTATACTACAGGACAAATGG + Intergenic
1197119563 X:122874317-122874339 TTAGTTTTCCTCAGGAAAAAGGG - Intergenic
1198173216 X:134128304-134128326 TTCTTCTTCCCCAGGGAAAATGG - Intergenic
1198314016 X:135448985-135449007 TTGTTGTTTTGGAGGAAAAAAGG - Intergenic
1198317011 X:135478089-135478111 TTCCTACTCTTCAGGGAAAATGG + Intergenic
1198495664 X:137190099-137190121 GTTTAGTTCTTTAGGAAAAAGGG + Intergenic
1198607010 X:138351801-138351823 TTCTTGTGCCTCAGGGAATAGGG - Intergenic
1198723097 X:139645650-139645672 TTCTTATCGTTCAGGCAAAATGG - Exonic
1199375069 X:147098458-147098480 TTATTGTTCTTCCTAAAAAATGG - Intergenic
1200648544 Y:5814193-5814215 TACTTGTTCTTCAGGTCAGAAGG + Intergenic
1200763614 Y:7062246-7062268 TACTTGTTATTAAGGGAAAAAGG + Intronic
1201275917 Y:12298517-12298539 TACTTTTTCTTCAGTAGAAAAGG - Intergenic
1201346052 Y:12985821-12985843 TTCTTCTTTTTAAGGAAAACTGG + Intergenic