ID: 933918959

View in Genome Browser
Species Human (GRCh38)
Location 2:87025565-87025587
Sequence TCCACTTCAGGTGAGATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933918959_933918962 5 Left 933918959 2:87025565-87025587 CCTTCCATCTCACCTGAAGTGGA No data
Right 933918962 2:87025593-87025615 CAGCCAAGTCACAACTTCCTAGG No data
933918959_933918965 28 Left 933918959 2:87025565-87025587 CCTTCCATCTCACCTGAAGTGGA No data
Right 933918965 2:87025616-87025638 TGATGCACGTCCATGCAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933918959 Original CRISPR TCCACTTCAGGTGAGATGGA AGG (reversed) Intergenic
No off target data available for this crispr