ID: 933927130

View in Genome Browser
Species Human (GRCh38)
Location 2:87104276-87104298
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 837
Summary {0: 3, 1: 8, 2: 62, 3: 190, 4: 574}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933927123_933927130 13 Left 933927123 2:87104240-87104262 CCTTTTTGGCACCAGGGACCAGC 0: 11
1: 450
2: 869
3: 1264
4: 1178
Right 933927130 2:87104276-87104298 ATTTTTCCACAGATGGGGCACGG 0: 3
1: 8
2: 62
3: 190
4: 574
933927126_933927130 -5 Left 933927126 2:87104258-87104280 CCAGCTTTGTGGAAGACAATTTT 0: 18
1: 302
2: 602
3: 924
4: 1132
Right 933927130 2:87104276-87104298 ATTTTTCCACAGATGGGGCACGG 0: 3
1: 8
2: 62
3: 190
4: 574
933927125_933927130 2 Left 933927125 2:87104251-87104273 CCAGGGACCAGCTTTGTGGAAGA 0: 11
1: 227
2: 496
3: 1112
4: 1361
Right 933927130 2:87104276-87104298 ATTTTTCCACAGATGGGGCACGG 0: 3
1: 8
2: 62
3: 190
4: 574
933927121_933927130 19 Left 933927121 2:87104234-87104256 CCACAGCCTTTTTGGCACCAGGG 0: 91
1: 1146
2: 1621
3: 1295
4: 1028
Right 933927130 2:87104276-87104298 ATTTTTCCACAGATGGGGCACGG 0: 3
1: 8
2: 62
3: 190
4: 574

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901304535 1:8223161-8223183 ATTTTTCCACAGCCGGGGGCTGG - Intergenic
901516792 1:9753081-9753103 ATTTCTCCACAGATGGGGGTGGG + Intronic
901687286 1:10949899-10949921 CCTTTTCCACAGGTGGGGAACGG + Intronic
901702713 1:11054062-11054084 ATTTGTCCACATAGGGGGCGGGG + Intergenic
901714232 1:11140295-11140317 ATTATTCCACAGATTGGGTGGGG + Intronic
901895285 1:12306748-12306770 ATTTTTCCACAGACAGGGTTGGG + Intronic
902600078 1:17534967-17534989 ATTTTTCCATGGATGGGGTGGGG + Intergenic
903317512 1:22520162-22520184 ATCTTCCCACACGTGGGGCAGGG - Exonic
903518925 1:23932625-23932647 ACTTTTCAACAAATGGGGCTGGG + Intergenic
903701935 1:25255558-25255580 ATTTTTCCACAGCTGGGGGTGGG + Intronic
904353053 1:29921373-29921395 ATTTTTCCACAGACGGGGGTGGG + Intergenic
905027045 1:34857793-34857815 ATTTTTCCACAGATGGGGGTTGG + Intronic
905246898 1:36621217-36621239 ATTTTCCCACAGATAGGTCGGGG + Intergenic
905333314 1:37224619-37224641 ATTTTGCCAAAGAGGTGGCATGG - Intergenic
905998259 1:42401034-42401056 ATTTTTCCACAGATGGGGGTGGG + Intronic
906440242 1:45836877-45836899 GTTTTTCCACAGATGGGTGGAGG + Intronic
906985718 1:50681367-50681389 ACTTTTCCACAGAACAGGCATGG + Intronic
907048622 1:51315116-51315138 AAGTTTCCACAGGTGGGGCTGGG - Intronic
907059379 1:51405794-51405816 AATTGTCCTCAGATGAGGCAAGG + Intronic
907630001 1:56071047-56071069 CTTTTTCCAGAGAAGAGGCATGG - Intergenic
907911215 1:58828328-58828350 ATTTTTCCATAGATGGGGCAGGG - Intergenic
908146261 1:61247762-61247784 ATTATTTCACAGCTGGGCCATGG + Intronic
908588718 1:65604880-65604902 ATTTTTCCACTAATGGGGGATGG - Intronic
909423901 1:75499219-75499241 ATTTTTCCATGGATGGGGGCCGG + Intronic
909533000 1:76701765-76701787 ATTTTTCCATGGATGGGGGCAGG + Intergenic
910182071 1:84495872-84495894 ATTTTTCTAGAGAAGAGGCAAGG + Exonic
910545206 1:88408106-88408128 ATTTTTACACAGATGAAGGAGGG + Intergenic
910686747 1:89925435-89925457 ATTTTTCCATGGACGGGGGAGGG - Intronic
910687269 1:89930078-89930100 ATTTTTCCAGAAATGGGGGTTGG - Intronic
911719730 1:101177819-101177841 ATTTTTCCACAGAGTGGGTTGGG - Intergenic
913173556 1:116253959-116253981 ATTTTTCCATGGATGGGGCAAGG - Intergenic
913270016 1:117084066-117084088 ATTTTTCCAATGATGGATCAGGG - Exonic
914319902 1:146549113-146549135 ATTTTTCCACAGATTGGGGGTGG - Intergenic
915205799 1:154269605-154269627 TGTTTTCCACAGCTGGGGAAGGG - Intronic
915411445 1:155703968-155703990 ATTTTTACAGAGATGGGGTCTGG - Intronic
915614156 1:157022911-157022933 TTTTTTCAACAAATGGGGCTGGG + Intronic
915962077 1:160275283-160275305 AGTTTTCCACAGAGGGGGGTGGG - Intergenic
916619211 1:166477563-166477585 ATTTTTCCACAGAGTGGGGTGGG + Intergenic
916874770 1:168957664-168957686 ACTTTTCCACAGATGGGCTCAGG + Intergenic
917031871 1:170701987-170702009 ATTTTTCCATGGATGGGGGAAGG + Intronic
917205622 1:172568141-172568163 GTTTTCCCATGGATGGGGCAGGG - Intronic
917815731 1:178708143-178708165 AAGTTTCCACAGCTGGGGCTGGG + Intergenic
918413772 1:184286875-184286897 AATTCCCCACAGATGGGGCTGGG - Intergenic
918460141 1:184767995-184768017 TTTTTTCCACGGATGGGGCAGGG - Intergenic
918699436 1:187589470-187589492 GTTTTTCCATGGATGGGGGATGG - Intergenic
919615278 1:199799501-199799523 ATTTTTCTACAGATAGGGGTTGG - Intergenic
919996567 1:202757052-202757074 ATTTTTCCATGGATGGGGAAGGG + Intronic
920580127 1:207098580-207098602 ACTTTTCCACGGATGGGGGTGGG + Intronic
921038927 1:211410623-211410645 TTTTTTCAACAGATGGTGCTGGG + Intergenic
921151863 1:212409139-212409161 ATTTTTCCACAGATGGAGGTTGG - Intronic
922010214 1:221575749-221575771 ATTTTTCCATGGATGGAGGAGGG - Intergenic
922254422 1:223880588-223880610 ATTTTTCCACAGATGCAGGCGGG + Intergenic
922293257 1:224226818-224226840 ATTTTTCCACAGACAGGGTCAGG + Intergenic
922328897 1:224556549-224556571 ATCTTTCCATGGATGGGGCAGGG + Intronic
922607627 1:226900362-226900384 AATTGTCCACAGAGGGGGCAGGG - Intronic
922607852 1:226902095-226902117 GTTTTTCCACAGATAGGGGTTGG + Intronic
922781417 1:228256049-228256071 ATTTTTCCACAGATGGGGGTTGG - Intronic
922865350 1:228856022-228856044 ATTTTTCCACAGACCAGGGATGG - Intergenic
923368094 1:233283432-233283454 ATTCTTCCAGGGCTGGGGCAGGG + Intronic
923512556 1:234665002-234665024 ATTTTTCCACGGTTGGGGGGTGG - Intergenic
923616745 1:235544655-235544677 TTTTTTCCACAGATGTGGGGTGG - Intergenic
923859871 1:237882879-237882901 GTTTTTGCACACATAGGGCAGGG + Intronic
923930724 1:238692936-238692958 ATGTTTTCCCAGATGGGGCAAGG + Intergenic
924893391 1:248308816-248308838 ATTTTTCCACTGATTGGGCAGGG - Intergenic
924895365 1:248332843-248332865 ATTTTTCCACTGATGTGGCAGGG - Intergenic
1063499457 10:6539681-6539703 ATTTTTCCACAGACTGGGGTGGG - Intronic
1063604669 10:7512207-7512229 ATTTTTCCACAGACAGTGGAGGG + Intergenic
1063700358 10:8378473-8378495 ATTTTTCAATAGAGCGGGCAGGG + Intergenic
1063784274 10:9362873-9362895 ATTTCTCCACGGATGGGGGCGGG - Intergenic
1064269492 10:13852111-13852133 ATTTTTCCACAGATGGGGTGTGG - Intronic
1064271868 10:13872502-13872524 ATTTTCCCACACATCGTGCATGG - Intronic
1064310394 10:14207288-14207310 ATTTTTCCACGGATGGGGGTGGG + Intronic
1064646382 10:17464350-17464372 TTTTTTCCACAGATGGAGTGGGG - Intergenic
1064744021 10:18461547-18461569 ATTTTTCCACAGGTGGGGAGGGG + Intronic
1065009923 10:21411704-21411726 ATTTTTCCACAGATGCGGGGTGG + Intergenic
1065505847 10:26429472-26429494 ATTTTTCCACAGATTGGTGGGGG - Intergenic
1065939562 10:30551758-30551780 ATTTTTCCACAGACTGGGGTGGG + Intergenic
1065960241 10:30728003-30728025 ATTTTTCCATGGATGGGGAGAGG + Intergenic
1066199465 10:33131279-33131301 ATTTTTCCACAGAGAGGGACAGG + Intergenic
1066285155 10:33958702-33958724 ATTTTTCCATGGATGGGGTAGGG + Intergenic
1066397515 10:35040712-35040734 ATTTTTCCACAGACGGAGTGCGG + Intronic
1067435806 10:46276178-46276200 AATTTTCCACAAATGGAGCTGGG - Intergenic
1068194129 10:53694379-53694401 TTTTTTCCACAGACGGGGGTAGG + Intergenic
1068505150 10:57891082-57891104 TTTTTTCCACAGATGGTGGTGGG - Intergenic
1068959220 10:62849879-62849901 ATTTTTCCACAGATGGGGGCTGG - Intronic
1069357268 10:67601263-67601285 ATTTTTCCACAGATGGTGGATGG + Intronic
1069605067 10:69733700-69733722 ATTTTTCCATAGACGGGGTGGGG - Intergenic
1070622289 10:78022425-78022447 AGTTTTCCATAGCTTGGGCAAGG + Intronic
1070795242 10:79212478-79212500 TTTTTTGCACAGATGGGGCTGGG + Intronic
1071323992 10:84493718-84493740 ACTTTTCCACAGATGGGGAGAGG + Intronic
1071357881 10:84816739-84816761 ATTTTTCCATAGATGGGGGTTGG + Intergenic
1071801260 10:89064246-89064268 ATTTTTCCAGAGAGGGGTCATGG - Intergenic
1071829406 10:89356783-89356805 GTTTTTCCACAGACTGGGCAGGG - Intronic
1071981913 10:91011930-91011952 ATTTTTTCACAGATGTTGGAAGG - Intergenic
1072056050 10:91756957-91756979 ATTTTTCCACAGATGGGGATGGG + Intergenic
1072332696 10:94369233-94369255 ATTTTTCCACAGATCAGGGTGGG + Intergenic
1072424536 10:95318799-95318821 ATTTTTCCACAGATGGGGTGGGG + Intronic
1072614653 10:97041422-97041444 AGTTATCCAGAGTTGGGGCATGG + Intronic
1073134113 10:101210449-101210471 TTTCTTCCAAAGATGGGGCAGGG - Intergenic
1073682498 10:105719421-105719443 ATTTTTCCACAGATGGAGGTGGG + Intergenic
1073715908 10:106107125-106107147 ATTTTTCCATGGATTGGGCATGG - Intergenic
1074124556 10:110517684-110517706 ATTTTCCCACAGACGGGGTTCGG - Intergenic
1074663435 10:115690266-115690288 ATTTTTCTACAGATGGGGGTGGG + Intronic
1074700289 10:116086562-116086584 CTTTTTGCACAAATGAGGCAGGG - Intronic
1075290149 10:121222361-121222383 ATTTTTCCACGGATGTGGAGTGG - Intergenic
1075776735 10:124993975-124993997 TTCCTTCCACAGATGAGGCAGGG - Exonic
1076201312 10:128560848-128560870 ATTTTTCCCCAGATGGCGGAGGG + Intergenic
1076247330 10:128957771-128957793 ATTTTTCCACAGCAGAGGAAAGG + Intergenic
1076314218 10:129529316-129529338 ACTTTTCCACAGATGGGAGTGGG + Intronic
1077087306 11:760289-760311 ATTTTTCCTCTGTTGGAGCAGGG + Intronic
1077505141 11:2926587-2926609 ATTTTTCCACGGATGTGGGTGGG + Intergenic
1077860846 11:6178480-6178502 ATTTTTCCACAGACAGGGGAAGG - Intergenic
1078099629 11:8322319-8322341 GTTTTTCCACAGATCGGGTAGGG - Intergenic
1078229790 11:9429972-9429994 ATTTTTCCACAGATGGTCCGGGG + Intronic
1078265230 11:9750569-9750591 ATTCTTCCCCAAATGAGGCAGGG + Exonic
1078396625 11:10987399-10987421 ATTTTTCCACAGATGGGAGGGGG - Intergenic
1078812690 11:14784127-14784149 ATTTTTCCACAGACTGGGTAGGG - Intronic
1078885856 11:15499201-15499223 ATGTTTCCTCAGAGGGGACAAGG - Intergenic
1079016357 11:16872255-16872277 AATTGTCTACAGGTGGGGCACGG - Intronic
1079785949 11:24673102-24673124 ATTTTTCCATGGATGGAGGAAGG - Intronic
1080242876 11:30147241-30147263 ATTTTTCCACAGATGGGGGTGGG + Intergenic
1080470231 11:32538353-32538375 ATTTTTCCATGGATGGGGGTCGG + Intergenic
1080492596 11:32782303-32782325 ATTTTTCCACAGACTGGGGCTGG - Intronic
1080722785 11:34866261-34866283 ATTTTCCCACAGATGGGGTGAGG - Intronic
1080723651 11:34873285-34873307 ATTTTTCCACAGATGGGGGCAGG - Intronic
1081215874 11:40397168-40397190 ATGTTTCCAGAGATTGGGTAGGG - Intronic
1081281182 11:41210840-41210862 ATTCTTCCACTGATGGGGGTTGG + Intronic
1081552564 11:44127554-44127576 ATTTTTCCACAGACTGGGTTTGG - Intronic
1081999231 11:47384029-47384051 AATTTTACACAGAGGGGGCCGGG + Intergenic
1082708842 11:56527915-56527937 ATTTTTCCATGGATGGGGGTTGG + Intergenic
1082841384 11:57692950-57692972 CTTTTTCCACAGATGGGGGCTGG + Intronic
1083369487 11:62166918-62166940 ATTTCTCCACATAGGCGGCAAGG - Intergenic
1083576675 11:63796899-63796921 ATTTTTCCACAGACAGGGTTGGG + Intergenic
1084175225 11:67419356-67419378 ATTGCCCCAGAGATGGGGCAGGG - Intronic
1086538494 11:87879354-87879376 ACTTTTCAACATGTGGGGCATGG + Intergenic
1086795881 11:91101540-91101562 ATTTTTCCATAGACAGAGCAAGG - Intergenic
1087016170 11:93556378-93556400 ATTTTTTCAGGGATGTGGCAGGG + Intergenic
1087160395 11:94942887-94942909 ATTTTTCCACAGATGGTGGGTGG + Intergenic
1087307232 11:96501548-96501570 TTGATACCACAGATGGGGCAAGG - Intronic
1087427407 11:98007786-98007808 ATTATTTCCCAGAGGGGGCAGGG - Intergenic
1088059292 11:105626798-105626820 ATTTTCTTACAGAAGGGGCAGGG + Intronic
1088185713 11:107166864-107166886 CTTTTTCCACAGATGTGGTCAGG + Intergenic
1088341488 11:108772832-108772854 ATTTTTCCACTGACAGGGGATGG - Intronic
1088641598 11:111878545-111878567 ATTTTTCCAAAGGTGAGGAAAGG - Exonic
1088736291 11:112730382-112730404 ATTTTTCCACTAATGGGGTGGGG - Intergenic
1088826141 11:113496094-113496116 ATGGTTCCACACAAGGGGCATGG - Intergenic
1089408838 11:118221387-118221409 ATTTTTCCACAGACCAGGGAGGG + Intronic
1089512760 11:119010891-119010913 GTTTTTCCACAGATGGACCCAGG + Intronic
1089730479 11:120515938-120515960 CCTTTTCCACAGATGAGGAAGGG + Intronic
1090591133 11:128270211-128270233 ATTTTTCCACAGATTGGGGGTGG - Intergenic
1090923029 11:131223921-131223943 ATTTTTCCAGAGGTTAGGCAGGG + Intergenic
1091755327 12:3047612-3047634 ATTTTTCCACGGATGGAGCGGGG - Intergenic
1091792106 12:3277852-3277874 AATTTCCCACAGATGGAGAAAGG - Intronic
1091897235 12:4115506-4115528 ATTTTTCCATGAATGGGGCAGGG - Intergenic
1091956178 12:4645420-4645442 ATTTTTCCACGGATGGGAGTGGG + Intronic
1092175889 12:6406632-6406654 ATTTTGTCATGGATGGGGCAGGG - Intergenic
1092554554 12:9543196-9543218 ATTTTTCCACAGATGGGGTGGGG + Intergenic
1092734293 12:11565526-11565548 ATTTTCCCACGGATGGGGGTTGG - Intergenic
1092948316 12:13476723-13476745 ATTCTTCCCCAGTTGGGGCTGGG + Intergenic
1093224538 12:16465778-16465800 ATTTTTCCACAGATTGGGGTGGG - Intronic
1093411897 12:18877602-18877624 ATTTTTCCACAGATGGGGTAAGG + Intergenic
1093651698 12:21653420-21653442 ATTTTTCCACAGATGTGTGAGGG - Intronic
1093661967 12:21767580-21767602 ATTTTTCCACTGATGGGGGTGGG - Intronic
1093766840 12:22973513-22973535 ATTTTTCCACAGATGAGGGTGGG + Intergenic
1094359197 12:29611787-29611809 TGTTTCACACAGATGGGGCAGGG + Intronic
1094517545 12:31147439-31147461 ATTTTTCCACAGATGGGGTGGGG - Intergenic
1094645744 12:32322377-32322399 ATTTTTCCACAGATAGGGTGCGG + Intronic
1094719094 12:33044237-33044259 ATTTTTCCACGGATGGGGGATGG + Intergenic
1094747644 12:33364114-33364136 ATTTTTCCACAGACTGGGATGGG - Intergenic
1095184064 12:39180425-39180447 ATTTTTCCATGGATGGGGAGGGG + Intergenic
1095184370 12:39184722-39184744 ATTTTTTCACGGATGGGGGGTGG - Intergenic
1095322662 12:40847834-40847856 GTTTTTCCACGGATGGGGTGAGG + Intronic
1095390057 12:41695329-41695351 ATTTTTTCATGGATGGGGAAGGG - Intergenic
1095393975 12:41742035-41742057 ATTTTTCCACAGATGGTGGGAGG + Intergenic
1095491051 12:42734219-42734241 ATCTTTCCATAGATGGGGGTGGG + Intergenic
1095574055 12:43714217-43714239 ATTTTTCCATGGACGGGGCAGGG - Intergenic
1095685733 12:45031050-45031072 AATTTTCCTCAAATGGGGGATGG + Intronic
1096431751 12:51550167-51550189 ATTTTGCCACAGACAGGGCAGGG - Intergenic
1096890024 12:54760339-54760361 AATTTTCCACAAATGGTGCCTGG + Intergenic
1097110562 12:56655001-56655023 ATTTTTCCATGGATGGGGGTGGG - Intergenic
1098140465 12:67445446-67445468 ATTTTTCCACTGATGGGCAAGGG + Intergenic
1098498351 12:71163012-71163034 ATGTGGCCACAGAGGGGGCAGGG - Intronic
1098846991 12:75549942-75549964 ATTTTTCCAGTGAGGGGGCAAGG + Intergenic
1099222240 12:79929050-79929072 ATTTTTCCACAGATGTGGGTTGG + Intronic
1099863531 12:88249349-88249371 ATTTTTCCACAGACGGGTTGGGG - Intergenic
1100324816 12:93530950-93530972 ATTTTTCCACAGACTGGGGTTGG + Intergenic
1100755868 12:97750397-97750419 ATTTTTCCATAGACTGGGGATGG + Intergenic
1100993684 12:100279149-100279171 GTTTTTCCACAGATGGGGGATGG + Intronic
1101364958 12:104063108-104063130 ATTTTTCCACGGACTTGGCAGGG - Intronic
1101375565 12:104168413-104168435 ATTCTTCCACAGATGGGAGCAGG - Intergenic
1101635530 12:106537607-106537629 ATTTTTCCATAGATGGGAGTAGG - Intronic
1102539057 12:113605327-113605349 CTTTTTGCAGAGATGGGGCGGGG + Intergenic
1102667243 12:114585597-114585619 ATTTTTCAATGGATAGGGCAGGG + Intergenic
1102970825 12:117164826-117164848 ATATTTCCAGAGAAGGGCCAGGG + Intronic
1103226375 12:119291520-119291542 ATTTTTCCACAGACGGGGTCAGG - Intergenic
1104603719 12:130171671-130171693 ACTTTTCCACACATGGCACAGGG + Intergenic
1104722191 12:131050737-131050759 ATTTTTGCACGGATGGGGTGGGG + Intronic
1104893818 12:132152402-132152424 ATTTATTCACAGGTGGGCCAGGG - Exonic
1105500854 13:20970508-20970530 ATTTTTCCATGGACGGGGAAGGG + Intergenic
1105718701 13:23092832-23092854 TTGTTTCCACAAATGGGGCTCGG - Intergenic
1106444137 13:29809371-29809393 TTTTTTCCTCAGATGTGCCAAGG - Intronic
1106457187 13:29937670-29937692 ATTTTTCCACAGATGGGGTCCGG - Intergenic
1106474310 13:30084301-30084323 ATTTTTCCACAGATGGGGTGGGG - Intergenic
1106776070 13:33011060-33011082 AGCATTCCAGAGATGGGGCAGGG + Intergenic
1106854248 13:33830935-33830957 ATTTTTCCATGGACTGGGCAGGG + Intronic
1107690301 13:42946933-42946955 ATTTTTCCATGAATGGGGCAAGG - Intronic
1107749540 13:43549958-43549980 ATTTTTCCACAGATGGCAGCAGG + Intronic
1107874440 13:44777706-44777728 ATTTTTCCAGGGATGGGAGAGGG + Intergenic
1108487138 13:50938536-50938558 ATTTTTCCATGGATGGGGCAGGG + Intronic
1110105461 13:71669570-71669592 TTTTTTCCACTGATGGGGGTGGG - Intronic
1110593455 13:77291804-77291826 CTTTTTCCTCAGAGTGGGCACGG - Intronic
1111592767 13:90371208-90371230 ATTTTTGTACAGATGGGTGAGGG + Intergenic
1111861636 13:93714730-93714752 GCTTCTCCACAGATGGAGCAAGG + Intronic
1113172477 13:107520808-107520830 ATTTTTCAACACATGGGGTAAGG + Intronic
1113626694 13:111853110-111853132 ATTTCTCCACAGATGGGGGGTGG - Intergenic
1114576606 14:23719989-23720011 ATTTTTCCACAGATGGAGCAGGG - Intergenic
1114897138 14:27005020-27005042 ATTTTTCCACGGATGGGGTGAGG - Intergenic
1115233419 14:31185812-31185834 ATTTAGCCAGAAATGGGGCAAGG - Intronic
1115327107 14:32152202-32152224 GTTTTTCCACAGATGGGTGGGGG - Intronic
1115788565 14:36854364-36854386 ACTTTTCCCCAGATGGAGCTAGG + Intronic
1116043370 14:39713455-39713477 ATTGTTAGAGAGATGGGGCATGG + Intergenic
1116423756 14:44764794-44764816 ATTTTTCCACAGATCAGGGGTGG - Intergenic
1117559130 14:56917930-56917952 ATTTTTCCATATATGGGGGTGGG + Intergenic
1117717248 14:58593965-58593987 ATTTTTCCACAGCTGGGGTTGGG - Intergenic
1117767743 14:59100476-59100498 ATTTTTCCACAGACTGGGTCGGG + Intergenic
1118305432 14:64651186-64651208 ATGTGTCCACAGGTTGGGCAGGG - Intergenic
1118943046 14:70356188-70356210 ATTTTTCCACAGATGGTGGCGGG + Intronic
1120428435 14:84381361-84381383 ATTTTTCCACGGATGGGGATGGG + Intergenic
1120924338 14:89782784-89782806 ATTTTTCCACAGATGAGATGGGG + Intergenic
1120988534 14:90354964-90354986 ATTTTTCCACGGATGGGGAGGGG + Intergenic
1121177076 14:91898612-91898634 ACTTTTCCACTGATGCGGAAAGG - Intronic
1121263521 14:92583791-92583813 ATTTTTCCACAGATGGGATGGGG + Intronic
1122144002 14:99677996-99678018 ATTTTTCCATGGATGGGGGTTGG + Exonic
1122158805 14:99768102-99768124 CTTCTCCCAGAGATGGGGCACGG + Intronic
1122170001 14:99864978-99865000 ATTTTTCCACAGAAGTGGGGCGG + Intronic
1122472767 14:101982674-101982696 ATTTTTCCACAGATGGTTGGGGG - Intronic
1124574109 15:30892648-30892670 ATTTTTCCACAGATGGGGTAAGG - Intergenic
1125499715 15:40232028-40232050 GTTTTTCCACAGATGGGGGATGG + Intergenic
1126037985 15:44565330-44565352 ATTTTTCCACAGACTGGGAGGGG + Intronic
1126046249 15:44643439-44643461 GTTTTTCAACAAATGGTGCAAGG + Intronic
1126136182 15:45394341-45394363 ATTTTTGCACAGATGGGGTGTGG - Intronic
1127159332 15:56164978-56165000 ATTTTTCCATGGATGGGGTGGGG + Intronic
1127202375 15:56669719-56669741 ATTATTCTACAGATGGGAAATGG + Intronic
1127550831 15:60036797-60036819 ATTTTTCTACGGATGGGGGTGGG + Intronic
1127618404 15:60709850-60709872 ATTTTTCCACAGAGTGGGGCAGG - Intronic
1127623994 15:60762442-60762464 CTTTCACCATAGATGGGGCAAGG - Intronic
1128014829 15:64334381-64334403 ATTTTTCCACAGACTGGGGGTGG + Intronic
1128220843 15:65967504-65967526 ATTCTTCTACAGACAGGGCAGGG + Intronic
1128555499 15:68628971-68628993 ATTTGCCTCCAGATGGGGCAGGG + Intronic
1128652994 15:69433625-69433647 ATTTTTACACAGATGGGTTGAGG - Intronic
1129047921 15:72753225-72753247 CTCTTACCACTGATGGGGCATGG + Intronic
1129218103 15:74113012-74113034 ATTTTTCTACAGACGGGGTCAGG + Intronic
1129406256 15:75320565-75320587 ATTTTTCCACAGACGGGGTTGGG - Intergenic
1129735216 15:77957054-77957076 ATTTTTCCACAGACGGGGTTGGG + Intergenic
1130790851 15:87154521-87154543 CTTTTTCAACAGATGGTGCTGGG + Intergenic
1131806975 15:96133028-96133050 TTTTTTCTACATATGTGGCATGG - Intergenic
1132032118 15:98446852-98446874 GTTTTTCCACGGATGGGGCAGGG - Intronic
1132050305 15:98602210-98602232 GTTTTTCCACAGATGTGGTGTGG - Intergenic
1132076516 15:98825632-98825654 ATTTTTCCACAGATGGGTGGGGG - Intronic
1133218703 16:4308740-4308762 TTTTTTGTAGAGATGGGGCAGGG + Intergenic
1133580117 16:7136710-7136732 AATTTTCCCTAGATGGGGCCAGG - Intronic
1133863704 16:9621390-9621412 ATTTTTCCACAGATCACGAAGGG + Intergenic
1133968008 16:10545782-10545804 ATTTTTCTACAGACTGGGGAGGG - Intronic
1133977311 16:10608492-10608514 ATTTTTCCACAGATGGGGGTTGG - Intergenic
1134307830 16:13049313-13049335 ATTATTTTACAGATGGGGAAAGG - Intronic
1134459873 16:14421700-14421722 AATTTTCCACGGATGGGGGCGGG - Intergenic
1135191405 16:20357728-20357750 ATTTTTCCAGGGATGGGGGTGGG + Intergenic
1135284607 16:21182600-21182622 ATTTTTCCATGGATGAGGCGTGG - Intergenic
1135868270 16:26125268-26125290 TTTTTTCCACAGATGGGGGTGGG + Intronic
1137332393 16:47511871-47511893 AGTTTTCCACGGATGGGGTAGGG + Intronic
1137366452 16:47863649-47863671 ATTTCTACACAGATGGGGAGTGG + Intergenic
1138611266 16:58126903-58126925 ATTTTTCCCCTCTTGGGGCAAGG - Intronic
1138694846 16:58803513-58803535 ATATTTCCATGGATGGGGAAGGG - Intergenic
1138731300 16:59198009-59198031 ATTTTTCCACGGATGGGGCGGGG + Intergenic
1140013624 16:71160964-71160986 ATTTTTCCACAGATTGGGGGTGG + Intronic
1140239256 16:73186245-73186267 GTTTTTCCACAGATGGTGAGGGG - Intergenic
1140358621 16:74326400-74326422 ATTTTTCCGCAGATTGGGACGGG + Intergenic
1140522905 16:75597510-75597532 ATTTTTCCACAGATCCGGGGTGG + Intronic
1141083793 16:81077097-81077119 ATTTCTCCACCCCTGGGGCAAGG - Intronic
1141327741 16:83078322-83078344 ATTTTTCCACATATTGGGGACGG + Intronic
1141552760 16:84817196-84817218 TTCATTTCACAGATGGGGCATGG + Intergenic
1142435079 16:90051506-90051528 ATTTTTCCACAGATGGGCTGAGG - Intergenic
1143066066 17:4248420-4248442 GTTTGTCCATAGATGGGGTAGGG - Intronic
1143083958 17:4402003-4402025 ATTTTTCCATGGATGGGTGACGG - Intergenic
1143119346 17:4597378-4597400 CTTCTTCCCCAGGTGGGGCATGG + Intronic
1143121800 17:4612551-4612573 CTGATTCCACAGTTGGGGCAAGG - Intergenic
1143279481 17:5741809-5741831 ATTTTTCCACGGACGGGGGTGGG + Intergenic
1143524834 17:7466077-7466099 CTTTTTCCACACTGGGGGCAGGG + Exonic
1143727668 17:8860489-8860511 ATTTTTCCACGGAAGGGGTTTGG - Intronic
1144450143 17:15370387-15370409 ATTTTTCCACGAATGGGGAGTGG + Intergenic
1144713616 17:17419550-17419572 ATTTTTCCACAGACTGGGGGTGG - Intergenic
1146116272 17:30142325-30142347 ATTTTTTTAGAGACGGGGCAGGG + Intronic
1146738118 17:35257101-35257123 ATTTTTTCACGGATGGGGGTTGG - Intronic
1147412405 17:40263195-40263217 ATTTTTCCATAGATGGTGGGCGG + Intronic
1147980877 17:44273117-44273139 ATTTTTGCACAGATCTGGCCTGG - Intergenic
1149040968 17:52187657-52187679 ATTTTTCCATAGATAGGGGCAGG + Intergenic
1149360436 17:55889412-55889434 AATTTTCCACAGATGTGGGCAGG - Intergenic
1150037925 17:61824569-61824591 TTTTTTCAACAAATGGTGCAGGG + Intronic
1151544830 17:74786376-74786398 CTTGGTGCACAGATGGGGCAGGG - Intronic
1151836711 17:76586648-76586670 ATTTTTCCACGGAGGGGGGTGGG + Intronic
1152014580 17:77741994-77742016 GTTTTTCCACAGACAGGACAGGG + Intergenic
1152219349 17:79053469-79053491 GTCCTTCCACAGCTGGGGCAGGG + Intergenic
1153677095 18:7465495-7465517 TTTTCTCCACAGATGGGGGGAGG + Intergenic
1153693321 18:7615685-7615707 ATTTTTCCACAGATGGGGTGGGG + Intronic
1153912209 18:9714239-9714261 ATTTTTCCACAGATGGGAGCAGG + Intronic
1154045628 18:10902202-10902224 ATTTTTCCACGGATGGGGGTAGG - Intronic
1154236240 18:12608955-12608977 ATTTTTCCACAAATGGGGGTGGG + Intronic
1154269063 18:12903738-12903760 ATTTTTGCACAGATGTGCAATGG + Intronic
1155320182 18:24611470-24611492 ATTTTTCCATGGATGGGGTGGGG - Intergenic
1155459966 18:26067851-26067873 ATTTTTCCACTGATGGTGGCCGG + Intronic
1155736113 18:29224526-29224548 ATTTTTCCAGCGACAGGGCAGGG - Intergenic
1155908299 18:31478795-31478817 ATTTTTCCACAGACGGCGGCAGG + Intergenic
1156053026 18:32961586-32961608 ATTTTTCCACAGACAGAGCAGGG + Intronic
1156151982 18:34253482-34253504 TTTCTTCCACAGATGGGAGAGGG - Intergenic
1156774664 18:40772372-40772394 ATTTTTCCATGGATGGGGGATGG + Intergenic
1157171409 18:45409818-45409840 ATTTTTCCACAGACCGGGGTTGG + Intronic
1157209980 18:45733990-45734012 AATTTTCCATGGATGGGGAATGG - Intronic
1157375624 18:47161688-47161710 ATTTTTCCACAGATGGGTTGGGG + Intronic
1157449901 18:47778015-47778037 ATTTTTCCGCAGACTGGGGAGGG + Intergenic
1157513848 18:48297040-48297062 AATTTTCCACAGACGGGGTGGGG - Intronic
1157768987 18:50327805-50327827 ATTTCTCCACAGACCGGGGAAGG + Intergenic
1157986886 18:52448282-52448304 ATTTTTCCACAGAGGGGCCAGGG - Intronic
1158940902 18:62405298-62405320 ATTTTTCCACAGATGGGCTGGGG + Intergenic
1159021773 18:63149190-63149212 ATTTTTCCACGAATGGGGTGGGG + Intronic
1159324586 18:66897863-66897885 ATTTTTCCACAGATGGTTGGGGG - Intergenic
1159984077 18:74821021-74821043 ATTTCTTCAGAGATTGGGCAGGG + Intronic
1160192521 18:76725809-76725831 GTTTTTCCACAGATGGTGGCAGG + Intergenic
1160281391 18:77494047-77494069 ATTTTTCCACAGATGAGATTGGG - Intergenic
1160334259 18:78023490-78023512 ATTTTTCCACAGACTGGGAGCGG + Intergenic
1160846503 19:1168427-1168449 ATGTTTTCACTGGTGGGGCAGGG - Intronic
1161431016 19:4232543-4232565 TTTTTTCTACAGATGGGGGGGGG - Intronic
1161564291 19:4991261-4991283 ATTTCACCACAGATGGGGGTAGG - Intronic
1161976284 19:7609573-7609595 ATTTTTCCACAGATGGAGGCAGG + Intronic
1162781171 19:13007654-13007676 TTGTGTCCCCAGATGGGGCAAGG + Intronic
1163205301 19:15798280-15798302 CTGTTTCCACACCTGGGGCATGG - Intergenic
1164318776 19:24119152-24119174 ATTTTTCCACATATGGTTTAAGG + Intronic
1164450210 19:28355363-28355385 ATTTTTCCACAGACTAGGGAGGG - Intergenic
1164794038 19:31012080-31012102 GTTTTTCAACAGATGGGGGAGGG - Intergenic
1164881752 19:31738733-31738755 ATTGCTCCCCAGATGGGGCTGGG - Intergenic
1165242478 19:34479903-34479925 ATTTTTCCACAGACAGGGATGGG - Intergenic
1165385705 19:35509679-35509701 CTTATACCACAGATGGGGCTGGG - Intronic
1165479244 19:36052414-36052436 GTTTTTCCACGGATGGGATAGGG - Intronic
1166402891 19:42496553-42496575 AGTTTTCCAAGGAAGGGGCAGGG + Intergenic
1166612886 19:44215068-44215090 ATTTTTCCACGGATGGGGGCGGG - Intronic
1166910448 19:46151330-46151352 ATTTTTCAACAAATGGTGCTGGG - Intronic
1167903837 19:52642077-52642099 ATTTTTACATAAATAGGGCAGGG + Intronic
1167932482 19:52877457-52877479 ATTTTTACATAAATAGGGCAAGG + Exonic
1168564559 19:57412232-57412254 ATTGTTCCACAGAGTGGGCCTGG - Intronic
1168593245 19:57653823-57653845 TTGATACCACAGATGGGGCAAGG - Intergenic
925744182 2:7030700-7030722 GTTTTTCCACAGACTGGGCAGGG + Intronic
925989938 2:9246578-9246600 ATTTTCACACAGGTGGGGCTGGG - Intronic
926176422 2:10596237-10596259 AGTTTTCCACAGATGGTGGTGGG + Intronic
926286547 2:11493292-11493314 ATTTTTCCACAGACAGGGTGTGG + Intergenic
927228063 2:20789876-20789898 ATTTTTCCACAGACTGGGGAGGG - Intronic
927259452 2:21072449-21072471 GTTTTTCCACGGATGGGGATCGG + Intergenic
927505112 2:23607823-23607845 ATTTTTCCATGGATGGGGCTGGG - Intronic
928201229 2:29248986-29249008 ATTTCTCCACCCATGGGCCAGGG + Intronic
928382012 2:30826123-30826145 TTTTTTCCACAGTTGTGGTACGG - Intergenic
928660294 2:33495243-33495265 GTTTTTCCACAGACAGGGCAGGG + Intronic
928675259 2:33644670-33644692 ATTTTTCCACAGACTGGGAGTGG - Intergenic
929174636 2:38963884-38963906 ATTTTTCCACAGACTGCGGAGGG + Intronic
929530156 2:42745553-42745575 ATTTTTACAGAGATGGGGGCAGG + Intronic
929547744 2:42866677-42866699 CTTCCTCCAGAGATGGGGCAGGG + Intergenic
930505807 2:52281729-52281751 TGTTTTTGACAGATGGGGCAGGG + Intergenic
931425182 2:62164394-62164416 ATTTTGCCACAGGTGGGCAAGGG + Intergenic
931542244 2:63342005-63342027 ATTTTTCCATGGATGGGGTGGGG + Intronic
932417989 2:71585311-71585333 AATTTTCAACAGGTCGGGCAGGG + Intronic
932725367 2:74175384-74175406 ATTTTTCCACAGATCTGGTTGGG - Intronic
932959979 2:76402245-76402267 ATTTTTCCACAGGTGGTGGCAGG - Intergenic
933056998 2:77683133-77683155 ATTTTTCCACAGATGGGGCACGG + Intergenic
933480458 2:82850868-82850890 ATTTTTCCATGGATCGGGGAGGG + Intergenic
933564436 2:83932448-83932470 AATTTACCAAAGATGGGGGAAGG + Intergenic
933583652 2:84155857-84155879 TTTTTTCAACAGATGAGGCTAGG - Intergenic
933647715 2:84825953-84825975 ATTTTTCCATGGATCGGGGAGGG - Intronic
933927130 2:87104276-87104298 ATTTTTCCACAGATGGGGCACGG + Intergenic
934954055 2:98601915-98601937 ATCTTTCCACGGACGGGGAAGGG - Intronic
934992703 2:98932871-98932893 ATTTTTCTACCTGTGGGGCAGGG - Intronic
935016272 2:99185214-99185236 ATTTTTCCACAGATAGGGAGGGG - Intronic
935433121 2:102999385-102999407 ATTTTTCCACAGATGAGGTGTGG - Intergenic
935565161 2:104598525-104598547 ATTTTTCCACAGACTGGGTAGGG + Intergenic
936906606 2:117542700-117542722 ATTTATCCACAGTAGGGGAAGGG + Intergenic
936958058 2:118043211-118043233 ATTTTTCAACAAATGGTGCTGGG - Intergenic
937167202 2:119831042-119831064 ATTTTTCCATGGATGGGGGGTGG + Intronic
937421526 2:121760311-121760333 ATTTTTCCACAGAAGGGGGGCGG - Intronic
937850333 2:126626679-126626701 ATTTTTCCACAGACTGGGTGGGG + Intergenic
938170170 2:129069191-129069213 CGATTCCCACAGATGGGGCAGGG + Intergenic
938985373 2:136570414-136570436 GTTTTTCCACAGATGTGGATGGG + Intergenic
938988818 2:136606945-136606967 CTTTTGCCACAGAAGGGCCATGG + Intergenic
939370428 2:141292236-141292258 ATTTTTCCACAGACCGGGATGGG - Intronic
939535714 2:143425173-143425195 ATTTTTGCACACATTTGGCATGG + Intronic
939726884 2:145731775-145731797 ATTTTTGCATAGATGTGCCATGG - Intergenic
940453269 2:153867539-153867561 ATTTTTCCACAGACTGGGAGAGG + Intergenic
940948463 2:159645381-159645403 ATTTTCCCACAGATGGAGCAAGG + Intergenic
940990698 2:160093132-160093154 GTTTTTCCACAGACTGGCCAAGG + Intergenic
941367308 2:164623102-164623124 ATTTTTCCACGGATGGGGTGGGG - Intergenic
941447720 2:165623446-165623468 ATTTTTCCACGGACTGGGGAGGG - Intronic
941676269 2:168346344-168346366 ATTTTTCCACAGACCAGGCAGGG - Intergenic
941935296 2:170976988-170977010 ATTTTTCCCCAGGTGGGTCTTGG + Intergenic
942497752 2:176557649-176557671 ATTTTTCCACAGATGTTGGGGGG - Intergenic
942549810 2:177103629-177103651 ATTTTTCCACAGACCGGGCTGGG + Intergenic
943156609 2:184187508-184187530 ATTTTTCCACATATGGGAGTGGG + Intergenic
943162298 2:184269847-184269869 ATTTTTCCATGGATGGGGGTGGG + Intergenic
943256732 2:185602996-185603018 ATTTTTACACGGATGGGGTTGGG - Intergenic
943648839 2:190435068-190435090 ATTTTTCCTCAGATGGAGAGGGG - Intronic
944069463 2:195653020-195653042 ATTTTTCCACAGATGGGGGTGGG - Intronic
944293111 2:198030430-198030452 GTTTTTCCACAGTTGGGGAAAGG + Intronic
945933450 2:215879804-215879826 ATTTTTCCACAGATGGTGGAGGG + Intergenic
946373174 2:219292960-219292982 ATTTTTCCACGGCTGGGAGAGGG - Intronic
946649472 2:221875250-221875272 ATTTTTCCACGGATGGGGGTAGG - Intergenic
946739797 2:222790248-222790270 ATTTTTCCACAGACGGTGGCAGG + Intergenic
947000875 2:225454776-225454798 CTTTTTCCACAGATGGGGAGGGG - Intronic
947111721 2:226725854-226725876 TTTTTTTCACATATGGGGGATGG + Intergenic
947911805 2:233805827-233805849 TTTTTTCAACAAATGGGGCTAGG + Intronic
948535789 2:238645686-238645708 ATTTTTCCACAGACCGGGGAAGG - Intergenic
948539806 2:238682525-238682547 ATTTTTCCACAGATGGGGCTGGG + Intergenic
948720774 2:239898772-239898794 AGTCCTACACAGATGGGGCAAGG + Intronic
948926328 2:241101047-241101069 ATTTTTCCACAGACTGGTGAGGG + Intronic
1169254614 20:4087259-4087281 ATTTTTCCTCAGACGGGGTAGGG + Intergenic
1169322050 20:4640987-4641009 ACTTTTCCACAGATGGGTGGGGG - Intergenic
1169640006 20:7741245-7741267 ATTTTTCCACAGATAGTGGTGGG + Intergenic
1170187035 20:13602591-13602613 ATTTTTCCATGGATGGGGTGGGG + Intronic
1170453317 20:16508440-16508462 ATTTTTCCACAGATAGGGGTAGG + Intronic
1172575508 20:36005221-36005243 ATTTTTTCACAGATGGGGGCAGG + Intronic
1172932449 20:38596090-38596112 GTCCTTCCACAGATGGGACATGG + Intergenic
1173131695 20:40399985-40400007 ATTCTTCAACTGAAGGGGCAAGG - Intergenic
1173873077 20:46353754-46353776 GGTTTTGCAGAGATGGGGCATGG + Intronic
1173926016 20:46781818-46781840 GTTTTTCCACAGATGGGGGCAGG + Intergenic
1174868938 20:54165499-54165521 ATTTTTCCATGGACAGGGCAGGG - Intronic
1174906459 20:54557262-54557284 ATTTTTCCACAGACGGGGTTGGG + Intronic
1176222139 20:63974740-63974762 ATTTTCCCAAAGATAGGGCAGGG + Exonic
1176308532 21:5137055-5137077 ATTTTTCCACAGACAGGGTTGGG - Intronic
1177597562 21:23265661-23265683 ATTTTTCCATGGATTGGGGAGGG - Intergenic
1177679186 21:24341810-24341832 AATTTTTCACAGATGGGGGAAGG + Intergenic
1178319776 21:31596583-31596605 ATTTTTCCATACATGGGGGTGGG - Intergenic
1178415932 21:32405116-32405138 ATTTTTCCAAAGATGGGGGTTGG + Intergenic
1178475030 21:32930534-32930556 ATTTTTCCATGGATGGGGTGCGG + Intergenic
1179057118 21:37946426-37946448 ATTTTTCCACAGACCAGGGATGG - Intergenic
1179848527 21:44124977-44124999 ATTTTTCCACAGACAGGGTTGGG + Intronic
1179898073 21:44374380-44374402 GTTTTTCCACAGATGGGGGCGGG + Intronic
1180100742 21:45583764-45583786 ATTTTTCCACAGATGAGGGGTGG + Intergenic
1180761109 22:18208618-18208640 ATTTTTCCACGGAGTGGGGATGG + Intergenic
1180774558 22:18416001-18416023 ATTTTTCCACGGAGTGGGGATGG - Intergenic
1180807711 22:18726820-18726842 ATTTTTCCACGGAGTGGGGATGG - Intergenic
1180938513 22:19641716-19641738 ATTTTTCCACCGATGGGGTTGGG - Intergenic
1181020111 22:20095653-20095675 ATTTTTCCACAGACGGTGTTGGG + Intronic
1181070670 22:20335009-20335031 ATTTTTCCACGGAGTGGGGATGG - Intergenic
1181193655 22:21162953-21162975 ATTTTTCCACGGAGTGGGGATGG - Intergenic
1181215788 22:21329646-21329668 ATTTTTCCACGGAGTGGGGATGG + Intergenic
1181235680 22:21446495-21446517 ATTTTGCCACAGATGTTGCAGGG - Exonic
1181846830 22:25717010-25717032 ATTTTTCCACAGACGGGGATGGG - Intronic
1182157984 22:28093855-28093877 ATTTTCCATCAGATGGGGAAGGG - Intronic
1183503663 22:38196443-38196465 ACTTTTCCACAGATGAGGGTGGG + Intronic
1183716934 22:39538562-39538584 CCTTGTCCACAGATGGAGCAGGG - Intergenic
1183941982 22:41301246-41301268 CTTTTGACACAGATGGGGAAGGG + Intergenic
1184706306 22:46215943-46215965 ATTTTTCCACAGATGGGGGTGGG - Intronic
1184773697 22:46612768-46612790 GTTTGTCTACAGCTGGGGCAAGG + Intronic
1184886943 22:47352252-47352274 GTGTTTCCACAGATGAGGCCAGG - Intergenic
949293698 3:2495759-2495781 ATTTTTCCACGGACCAGGCAAGG - Intronic
949333781 3:2951238-2951260 ATTTTTCCACAGATGGCGGGTGG + Intronic
949602389 3:5614195-5614217 ACTGTTCCACAGATAGAGCAGGG - Intergenic
950214011 3:11145089-11145111 AGTAATCCACAGATGGGGTATGG - Intronic
950952825 3:17018537-17018559 TTTTTTCAACAGATGGGGCCTGG + Intronic
951551427 3:23878909-23878931 ATTTTTCCACAGATGGGGGGTGG - Intronic
951553621 3:23899024-23899046 ATTTTTCCACAGATGGAGATGGG - Intronic
952088771 3:29858724-29858746 ATTATTCCCCTTATGGGGCATGG + Intronic
952248705 3:31627382-31627404 ATTTTTCCACGGATGGCGGAGGG - Intronic
952459005 3:33504656-33504678 ATTTTTCCACGGATGGGGAAGGG + Intronic
952600232 3:35071106-35071128 TTTTTTCCACAGAAGGGTTAGGG - Intergenic
953227422 3:41033443-41033465 ATTTTTCCACGGATGGGGGAAGG + Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953707015 3:45238882-45238904 ATTTTTCCACACATGGGGTAGGG - Intergenic
954725032 3:52601309-52601331 ATTTTTCCACAGACAGGGATGGG + Intronic
955141502 3:56274307-56274329 ATTTTTCCACAAACAGGGCTGGG - Intronic
956298244 3:67738227-67738249 CTTTTTCCACAGATGGGCTGGGG + Intergenic
956335819 3:68162270-68162292 ATTTTTCCACAGATGGGGTTGGG + Intronic
957212776 3:77281726-77281748 ATATTTCCATGGATGGTGCAGGG + Intronic
957669170 3:83278424-83278446 ATGTTTCCTCACATGGGGGAAGG - Intergenic
957783096 3:84845049-84845071 ATTTTTCCATGGATGGTGCAAGG - Intergenic
957801585 3:85090885-85090907 ATTTTTCCACAGATGGAAAGGGG - Intronic
958189186 3:90162623-90162645 ATTTTTCCACAGATTGGTGGTGG + Intergenic
958822844 3:98995577-98995599 GTTTTTCCACAGGAGGGGAAGGG + Intergenic
959106531 3:102071160-102071182 ATTTTTCCATGGATGGGGGAGGG + Intergenic
959378408 3:105612932-105612954 GTTTCTCCAGAGATGGGGCTGGG - Intergenic
960070647 3:113426242-113426264 CTTCTTCCACAGCTGGAGCAGGG + Exonic
960086139 3:113593462-113593484 ATTTTTCCACAGACGGGGGTGGG - Intronic
960796318 3:121492040-121492062 ATTTTTCCACAGACCGGGGGTGG - Intronic
960960199 3:123065356-123065378 AGTTTTCCACAGATGGTGGGGGG + Intergenic
961191732 3:124968052-124968074 AATATCCCACAGATGGGGGAAGG - Exonic
961199629 3:125033969-125033991 ATTTTTCCACGGATAGGGCGGGG - Intronic
961488775 3:127236253-127236275 AATTTTCCACAGATGAGGGGAGG - Intergenic
961514714 3:127425385-127425407 ATTTTTCCCCAGGTGAGGGAGGG - Intergenic
961580809 3:127880478-127880500 ATTTTTCCACTGATGAGGGTGGG + Intergenic
961727263 3:128939718-128939740 ATTTTTCCACGGACGGGGTTGGG + Intronic
961778216 3:129305380-129305402 ATTTTGTCACAAATGGGGCATGG + Exonic
961842044 3:129722408-129722430 ATTTTTCCACAGATGGGGTCGGG - Intronic
962110774 3:132444225-132444247 ATTTTTCCATGGACAGGGCAGGG - Intronic
962468842 3:135687198-135687220 ATTTTTCCACAGACTGGGCAGGG - Intergenic
962574628 3:136745439-136745461 ATTTTTCCACGGATGGGGTGGGG + Intronic
962857655 3:139363465-139363487 ATTTTTCCACAGATGGGAAGGGG - Intronic
962950735 3:140216215-140216237 ATTTTTCCATGGATGGGGGTGGG - Intronic
963166375 3:142208523-142208545 TTTTTTCAACAGATGGTGCTGGG - Intronic
963305515 3:143648301-143648323 ATTTTTCCACGGATTGGGGGAGG + Intronic
964133776 3:153320354-153320376 ATTTTTCCAGTGTTGGGGAAAGG + Intergenic
964209624 3:154212579-154212601 ATTTTTCCACAGACGGGTGGGGG + Intronic
964264034 3:154873925-154873947 ATTTTTCCACAGATGGGGTCAGG - Intergenic
964583115 3:158261995-158262017 ATTTTTCCATGGATGGGGCTGGG - Intronic
965440180 3:168702837-168702859 ATTTTGCTAGAGATGTGGCAGGG - Intergenic
965946069 3:174242802-174242824 ATTTTTCCATGGATGGGGGCGGG - Intronic
965971170 3:174558329-174558351 GTTTTTCCACAGACTGGGTACGG + Intronic
966162817 3:176985773-176985795 AGTACTCCACATATGGGGCAAGG - Intergenic
966171745 3:177089424-177089446 CTTTTTCCACCTAAGGGGCAAGG - Intronic
966217900 3:177521246-177521268 ATTTTTCCATGGACGGGGGAGGG + Intergenic
966222781 3:177566994-177567016 ATTTTCCCATAGACAGGGCAGGG - Intergenic
966358439 3:179107447-179107469 ATTTTTCCACAGACTGGGGTAGG + Intergenic
966563713 3:181352226-181352248 GTTTTTCCACAGATGGGAGTAGG + Intergenic
967813636 3:193781102-193781124 AATTTTCCCCAGACGGGGCATGG + Intergenic
969925938 4:10585925-10585947 GTATTTCCACAGATGGGGGTGGG + Intronic
970038807 4:11772501-11772523 ATTTTTCCACAGACTGGGATGGG + Intergenic
970411381 4:15811502-15811524 ACTTTTCAACAAATGGTGCAGGG - Intronic
970690395 4:18612965-18612987 ATTTTTCCACAGATGAGGGTTGG + Intergenic
970900485 4:21152902-21152924 ATTTTTCCACAGACAGGGTTGGG - Intronic
970929855 4:21496892-21496914 ATTTTTGCACAGACAGAGCAGGG - Intronic
971110954 4:23585631-23585653 ATTTTTCCTCAGTGGTGGCAGGG - Intergenic
971556281 4:28016140-28016162 GTTCTTCCACAAATTGGGCAAGG + Intergenic
971879476 4:32351559-32351581 AGTTTTCCACAGATGGGCAGAGG + Intergenic
972670444 4:41209937-41209959 ATTTTTCCACGGATGGGGTTGGG + Intronic
972744837 4:41922761-41922783 ATTTTTCCACAGACGGGAGTAGG - Intergenic
973117467 4:46478878-46478900 ATTTTTCCACGGACGGGGATGGG - Intergenic
973212458 4:47631672-47631694 ATTTTTCCACAGACTGGGATGGG - Intronic
974144810 4:57934076-57934098 ATTTGTCCCCAGGTGGAGCAAGG - Intergenic
975070688 4:70133850-70133872 ATTTTTCCACGGATGAGGGCGGG - Intronic
975646952 4:76555176-76555198 ATTTTTCCACGGATGGGGTGTGG - Intronic
975725328 4:77285957-77285979 ATTTTTCCACAGAAGGGTCTGGG + Intronic
976164032 4:82234491-82234513 ACTTTCACACAGAGGGGGCAAGG + Intergenic
976342349 4:83959249-83959271 ATTTTTCCACAGACAGGGAGTGG + Intergenic
976623427 4:87152652-87152674 ATTTTGCCACGGACAGGGCAGGG + Intergenic
976674596 4:87690562-87690584 ATTTTTCCATGGATGGGGTGAGG - Intergenic
977235181 4:94499948-94499970 ATTTTTCCACAGGTGGGTCAGGG - Intronic
977405743 4:96596172-96596194 ATTTTGCGACATATGTGGCAGGG + Intergenic
979227990 4:118312006-118312028 ATCTTTCAAAAGAAGGGGCAAGG + Intronic
979485306 4:121263723-121263745 TTTTTTGCACAGATGGGGCAAGG + Intergenic
979539421 4:121864151-121864173 GTTTTTCCACCAATGGGGCTGGG - Intronic
979651467 4:123136964-123136986 ATTTTTCCACAGGTGTGGGGCGG + Intronic
979661519 4:123261088-123261110 ATTTTTCCACAAATGGGGTGGGG - Intronic
979920797 4:126493414-126493436 ATTTTTCCACAGATGAAGTAGGG + Intergenic
980501115 4:133655629-133655651 GTTTTTCTACAGATGGGGCATGG + Intergenic
980910860 4:138993108-138993130 ATTTTTCCACGGACGGGGTGGGG - Intergenic
981734741 4:147937072-147937094 ATTTTTCCACCGATTGGGGTGGG - Intronic
981755923 4:148141879-148141901 AATTTTCCACAGACCTGGCAGGG - Intronic
981786308 4:148483110-148483132 ATTTTTCCACAGACTGGGGTGGG - Intergenic
982086303 4:151840212-151840234 ATTTTTCCACAGACTGGGGGTGG - Intergenic
982896920 4:160942005-160942027 AGTTTTCCACAGATGGGGGTGGG + Intergenic
983040859 4:162924043-162924065 ATGTTTCCATAGATGGGGGTGGG - Intergenic
983251818 4:165354241-165354263 ATTTTTTCACAGACGGGGTGGGG + Intergenic
983700095 4:170581397-170581419 ATTTTTCCACAGAAGGGGCCAGG + Intergenic
984072933 4:175139036-175139058 ATTTTTCCACAGACTGGGGTGGG + Intergenic
984364929 4:178786273-178786295 ATTTTTCCATGGATGGGGGGTGG + Intergenic
984609289 4:181819594-181819616 AATTTTCCACAGATGGAGGGTGG + Intergenic
984736082 4:183109453-183109475 ATTTTTCCACAGAATGGGATTGG + Intronic
984911717 4:184679887-184679909 ATCTTTCCATGGGTGGGGCAGGG - Intronic
985391315 4:189493429-189493451 ATTTTTCCTCAAAAGGGCCATGG - Intergenic
985530012 5:428583-428605 ATTTTTCCACAGACTGGGAGTGG + Intronic
985624028 5:975278-975300 ATTTTTCCACTGATGGAGAAGGG - Intergenic
985624078 5:975686-975708 ATTCTTCCACTGATGGAGAAGGG - Intergenic
985624102 5:975890-975912 ATTCTTCCACTGATGGAGAAGGG - Intergenic
985887315 5:2689634-2689656 ATTTTTCCATAGATGGGGCAAGG - Intergenic
986238226 5:5932667-5932689 ATTTTACCACATATGAGGCAGGG + Intergenic
986306872 5:6522736-6522758 ATTTTTCCAGAGATGGAGGCTGG + Intergenic
986418882 5:7556876-7556898 ATTTTTCCACGGATGAGGTGGGG - Intronic
987012869 5:13784966-13784988 ATTTTTCCACGGATGGGACGGGG + Intronic
987035250 5:14012807-14012829 GTTTTTCCACAGGTGGGGCAGGG + Intergenic
987134977 5:14892002-14892024 ATTTTTCCGCAGATGGAGTAGGG - Intergenic
988390047 5:30616172-30616194 ATTTTTCCACGGATGGAGGGGGG - Intergenic
988392911 5:30658872-30658894 ATTTTTCCATGGATGGTGGAAGG + Intergenic
988440644 5:31228584-31228606 ATTTTTCCACAGATGTGGTGGGG + Intronic
988560838 5:32279703-32279725 ATTTTTCCACGGACCTGGCAGGG + Intronic
988626143 5:32876760-32876782 ATTTTTCCGCGGATGGGGATGGG - Intergenic
988641739 5:33048324-33048346 ATTTTTCCATGGATGGTGAAGGG + Intergenic
988784774 5:34556378-34556400 TTTTTTCCCCAGGAGGGGCACGG + Intergenic
988808161 5:34759763-34759785 ATTTTTCCACAGACCAGGTACGG - Intronic
988813599 5:34808792-34808814 ATTTTTCCATGGATGGGGGTGGG + Intronic
989089076 5:37710503-37710525 ATATTTCCACAGACAGGGCCAGG + Intronic
989093396 5:37757643-37757665 ATTAATCCACAGTTTGGGCAGGG - Intergenic
989472487 5:41836558-41836580 CTTTTTCCACAGATGGGGGTTGG + Intronic
990650836 5:57897867-57897889 ATTTTTCCACGGATGGAGGTTGG + Intergenic
990968143 5:61471764-61471786 AATTTTCCATGGATGGGGGAAGG - Intronic
990972147 5:61519804-61519826 GTTTTTCCACGGATGGGGGGTGG + Intronic
991066235 5:62427759-62427781 ATTTTTCCACAGATGGGGCAGGG - Intronic
991107806 5:62862869-62862891 ATTTTTCCAAAGATGATACATGG - Intergenic
991144870 5:63289300-63289322 TTGATTCCAGAGATGGGGCACGG - Intergenic
991172665 5:63646599-63646621 ATTTTTCCACAGATGGGGTGGGG + Intergenic
991625242 5:68594299-68594321 ATTTTTCCACAGATGGGGGTGGG - Intergenic
991985953 5:72287210-72287232 GTTTTTCCACAGCTGGGGGTTGG - Intronic
992299598 5:75364588-75364610 ATTTTTCTACAGATGGGGTGGGG + Intergenic
992567026 5:78007533-78007555 ATTTTTATACAGCTAGGGCAGGG - Intronic
993037264 5:82771422-82771444 ATTTTTCCACAGACCAGGGACGG + Intergenic
993140373 5:84025574-84025596 ATTTTTCCACAGACTGGGTTGGG - Intronic
993855261 5:93066379-93066401 ATTTTTCCACAGATGGGGGTTGG - Intergenic
993913115 5:93708444-93708466 ATTTTTCCACACATGGGGAGTGG + Intronic
993954809 5:94219071-94219093 ATTTTTCCACAGATGGGGGCGGG + Intronic
994112342 5:96020839-96020861 ATTTTTCCACAGATGGGTTGGGG - Intergenic
994329462 5:98488612-98488634 ATTTTTATACAGATGGGGGTGGG + Intergenic
994708876 5:103241528-103241550 ATTTTTCCACAGATGAGGTGTGG - Intergenic
994748595 5:103710216-103710238 ATTTTTACACAGAAGTGGGAAGG + Intergenic
994938216 5:106284378-106284400 ATTTTTCCACGGATGGGGTAGGG + Intergenic
994952004 5:106475433-106475455 AATTTTCCACTGATGGGGTGTGG - Intergenic
995962017 5:117853286-117853308 ATTTTTCTACAGATGGGGTCAGG + Intergenic
996325814 5:122271974-122271996 CTTTTTCAACAAATGGTGCAGGG + Intergenic
996331179 5:122330734-122330756 ATTTTTCCATAGTTGGGGGAGGG + Intronic
996458970 5:123719383-123719405 TTTTTTCCGCAGATAGGGGAAGG - Intergenic
996808695 5:127488865-127488887 ATTTTTCCATGGATGGGGATGGG + Intergenic
997169457 5:131701226-131701248 ATTTTTTCACGGATGGGGCTGGG - Intronic
997963756 5:138341578-138341600 ATTTTTCCACCGATAGAGAAGGG + Intronic
998008064 5:138670685-138670707 ATTTTTCCACAGACGGAGGGAGG + Intronic
998091501 5:139373500-139373522 ATTCTCCCTCAGGTGGGGCAGGG + Intronic
998240787 5:140442405-140442427 ATTTTTCCACACGTGGGGGAGGG + Intronic
998674280 5:144389660-144389682 TTTTTTCCACAGATTGGGCCAGG - Intronic
998915792 5:147010284-147010306 ATTTTTCCACAGACTGGGGCAGG + Intronic
999193734 5:149767811-149767833 GTTTTTCCACAGATGGGGTTGGG + Intronic
999512640 5:152268708-152268730 ATTTTTCCACAGATGGTTGGGGG + Intergenic
999702360 5:154239569-154239591 ATTTTTCCACGGATGGGGACCGG - Intronic
999725711 5:154435651-154435673 ATTTTTCCACGGTTGGGGGTGGG - Intergenic
999761823 5:154707619-154707641 ATTTTTCCACAGCTGGGGTGGGG + Intergenic
1000184319 5:158844060-158844082 AGTTTCCCACAGTTGGGGTAAGG - Intronic
1000656370 5:163884137-163884159 ATTTTTCCATGGATGGGGTGAGG + Intergenic
1000749864 5:165081217-165081239 ATTATTCCACAGGTGGAGCAAGG + Intergenic
1001456392 5:171863864-171863886 ATTTTTTCACTGATGAGGGAAGG + Exonic
1001468147 5:171987123-171987145 GTTTTTCCACAGACCAGGCACGG - Intronic
1001728008 5:173924086-173924108 ATGTTTCTACAGATGGAGGAAGG - Intronic
1001756029 5:174170767-174170789 ATTTTTCCATAGATAGGGTGGGG + Intronic
1002195643 5:177499559-177499581 ATTTTTCCACAGACTGGGGGTGG - Intergenic
1003860598 6:10319026-10319048 AAATGTCCACAGCTGGGGCATGG + Intergenic
1003913955 6:10768040-10768062 ATTTTTCTACAGATGGTGATAGG - Intronic
1003948456 6:11096178-11096200 ATTTTTCCACAGACGGAGCAGGG + Intronic
1004373756 6:15074599-15074621 ATTTTTCCACAGATGGAGGGTGG + Intergenic
1004911782 6:20292744-20292766 ATTTTTCCCCAGATGGGACGGGG + Intergenic
1004949762 6:20655696-20655718 ATTTTTCCACAGACCGGGGGTGG - Intronic
1005086819 6:22015397-22015419 ATTTTTCCACGGATGGCGGTGGG - Intergenic
1005527498 6:26665321-26665343 AATTTTCCACAGATGGTGGAGGG - Intergenic
1005673662 6:28132516-28132538 ATTTTTCCAAGGATAGGGAAGGG + Intergenic
1006512822 6:34530783-34530805 ATTTTTCCACGGATGGGAGCGGG + Intronic
1006725997 6:36199345-36199367 ATTTTTCCACAGATGAGGGTGGG - Intronic
1007729997 6:43939836-43939858 AAATTTCCTCAGAGGGGGCAGGG - Intergenic
1008001515 6:46365163-46365185 ATTTTTCTACAGATGGGGTGAGG - Intronic
1008335710 6:50302250-50302272 ATTTTTCCATGGATAGGGAAAGG - Intergenic
1008428684 6:51389134-51389156 ACCTTTGCACAGTTGGGGCATGG + Intergenic
1008523902 6:52388443-52388465 ATTTTTCCACGTATGGGGGCTGG - Intronic
1008694139 6:54014414-54014436 ATTTTTCCACAGATGGGGCTAGG + Intronic
1009303124 6:62052588-62052610 ATTTTTCCACTGGTGGGGTGGGG + Intronic
1009526101 6:64748344-64748366 ATTTTTCCACAGACAGGGTGAGG + Intronic
1010877149 6:81120763-81120785 ACTTTTCCACAGATGGGGTGTGG - Intergenic
1011569914 6:88724546-88724568 ATTTTTCCACAGACAGGGGAAGG + Intronic
1011752623 6:90468560-90468582 ATTTTTCCACATATGGGGTATGG - Intergenic
1011894170 6:92203031-92203053 ATTTTTCCACAGACCAGGTAGGG - Intergenic
1013333649 6:109133219-109133241 GTTTTTCCACAGATGCGGCAGGG + Intronic
1013465818 6:110416038-110416060 ATTTTTCCACAGACTGGGGATGG + Intergenic
1013547586 6:111173897-111173919 ATTTTTCCATGGATGGTGCCGGG - Intronic
1014010436 6:116469413-116469435 ATTTTTCCACAGACAGGGGTGGG + Intergenic
1014102794 6:117530285-117530307 GTTTTTCCACAGACGGGGTGGGG + Intronic
1014527590 6:122519456-122519478 ATTTTTCCACAGACGGAGGTGGG - Intronic
1014735449 6:125089777-125089799 ATATTTCCCAAGCTGGGGCATGG - Exonic
1015135767 6:129868222-129868244 ATTTTTCCCCAGTTGGAGCCTGG - Intergenic
1015465584 6:133544779-133544801 ATTTTTCCACAGATGGGGGCGGG - Intergenic
1015508508 6:134014116-134014138 ATTTTTCCACAGACGGGGGCAGG + Intronic
1015553885 6:134440919-134440941 ATTTTTCCACAGATGGGACTGGG - Intergenic
1015819579 6:137246025-137246047 GTTTTTCCACAGATGAGGGCAGG + Intergenic
1015973861 6:138769625-138769647 ATCTTTCCATGGATGGGGCGGGG + Intronic
1016845023 6:148561249-148561271 ATTTTTCCGTAGATGGGGTGGGG - Intergenic
1017097299 6:150815929-150815951 ATTTTTCCACGGATGGAGGCAGG + Intronic
1017207546 6:151819772-151819794 ATTTTTCCACAGATGGAACTGGG - Intronic
1017260106 6:152376021-152376043 ATTTTTCCACAGATGGGGTGGGG + Intronic
1017318229 6:153057583-153057605 ATTTTTCCACGGATGGGTGTGGG + Intronic
1017638669 6:156468560-156468582 TTGTGTCCACAGATGGGGCCTGG - Intergenic
1018045860 6:159965770-159965792 ATTTTTCCATGGATGGTGGAGGG - Intergenic
1018464955 6:164035477-164035499 TTTTTTGCAGAGATGGGGGAGGG + Intergenic
1018515374 6:164573868-164573890 ATCTTTCTACAGTTAGGGCAGGG + Intergenic
1019275449 7:173269-173291 CTGTGTCCACAGATGGGGCAGGG + Intergenic
1019385064 7:750449-750471 ATTTTTCCATGGGTGGGGCAGGG + Intronic
1020151693 7:5686778-5686800 ATTTTTCCACGGACAGGGCGTGG + Intronic
1020663373 7:11008595-11008617 ATTTTTCCATGGATGGGACAGGG - Intronic
1021000508 7:15324652-15324674 ATTTTCCCACAGATGGTGGGGGG + Intronic
1021560282 7:21962522-21962544 ATTTTTCCACGGATGGGTTGAGG + Intergenic
1022746646 7:33179737-33179759 ATTTTTCCACAGACCAGGAAGGG - Intronic
1022833223 7:34088860-34088882 ATTGTTCCACAGATGCATCAGGG - Intronic
1023153065 7:37220805-37220827 CTTCTTTCACAGATGGGGAAAGG + Intronic
1023199700 7:37682992-37683014 ATTTTTCCACAGACAGGGGTGGG - Intergenic
1023728770 7:43170358-43170380 ATTTTTCCACAGACAGGGGTGGG - Intronic
1023783699 7:43684127-43684149 TTTTTTCCACAGAGGAGGCAGGG + Intronic
1024156676 7:46632989-46633011 ATTTTACCAGACATTGGGCAAGG + Intergenic
1024650838 7:51402125-51402147 ATTTTTCCACAGACTGGGAGTGG + Intergenic
1024854981 7:53768391-53768413 ATTTTTCTACATGTGGGGAATGG + Intergenic
1025054959 7:55757705-55757727 ATTTTTCCACAGACTGGGAGTGG + Intergenic
1025104907 7:56162808-56162830 ATTTTTCCACGGATGGGGGTTGG - Intergenic
1025133030 7:56387927-56387949 ATTTTTCCACAGACTGGGAGTGG + Intergenic
1025246245 7:57319676-57319698 ATTTGTCCTAAGATGGGACAAGG - Intergenic
1026149563 7:67776416-67776438 ATTTTTCCAAGGATGGGGTTGGG + Intergenic
1026314053 7:69212477-69212499 ATTTTTCCACAGATAAGGGGTGG - Intergenic
1026434775 7:70386187-70386209 ATTTTTAGACAGATGGCCCAGGG - Intronic
1027494760 7:78873700-78873722 ACTTTTCCACAGACAGGGCAAGG - Intronic
1027747000 7:82088832-82088854 ATTTTTCCACAAATGGAGGTGGG + Intronic
1028057198 7:86261173-86261195 ATTTTTCCACGGACGGGGAAGGG + Intergenic
1028297148 7:89148002-89148024 ATTTTTCCACAGACAGGGCAAGG - Intronic
1028348672 7:89816428-89816450 ATTTTTCCACAGATGGGGGCAGG + Intergenic
1028479812 7:91292460-91292482 ATTTTTCCACAGATTGGGGTAGG - Intergenic
1029883123 7:103837704-103837726 ATCTGTCCAAACATGGGGCAGGG - Intronic
1030479263 7:110081879-110081901 ATTTTTCCATGGATGGGGGCAGG + Intergenic
1030613824 7:111717145-111717167 ATTTTTCCATAGACAGGGTAGGG - Intergenic
1030759984 7:113338516-113338538 ATTTTGCCAGAGCTGGGGTAAGG - Intergenic
1030948805 7:115763330-115763352 ATTTTTCCACGGAAGGGGAGTGG + Intergenic
1031169685 7:118277039-118277061 ATTTTTCCACAGAGGAGGTGGGG - Intergenic
1031221820 7:118976319-118976341 ATTTTTCCACGGACGGGGAGGGG + Intergenic
1031240768 7:119236546-119236568 CTTTTTCCAGAGATGGAGGAAGG - Intergenic
1031840305 7:126729407-126729429 ATTTTTCCACCCAAGGGGTAAGG - Intronic
1032073395 7:128823833-128823855 ATTTTTCCACAGATGGAGAGGGG + Intergenic
1033051599 7:138009233-138009255 ATTTTACCACTGCTGGGGCCAGG - Intronic
1033853102 7:145521962-145521984 ATTTTTCCACAGATGGGTTGTGG - Intergenic
1034905436 7:154940647-154940669 ATTTTCCCATAGATTGGGTAGGG - Intronic
1035678819 8:1472655-1472677 TATTTTCTACAGATGAGGCAAGG + Intergenic
1035774094 8:2173959-2173981 ATTTTTCCACGGACGGGGTGAGG + Intergenic
1035813017 8:2508139-2508161 ATTTTTCCATGGACAGGGCATGG - Intergenic
1035922614 8:3694186-3694208 ATGTGTCCATAGATGGGGCAGGG + Intronic
1036132707 8:6131276-6131298 ATTTTTCCACGGATGAGGACGGG + Intergenic
1036196815 8:6724968-6724990 GTTTTTCTACAGATGGCACATGG + Intronic
1036578596 8:10052378-10052400 TTTTTTCCACAGATGGGGAAGGG - Intergenic
1036617627 8:10400767-10400789 ACTTTTCAACAGATGGTGCTGGG + Intronic
1037163834 8:15802603-15802625 ATTTTTCCTCAAGAGGGGCATGG + Intergenic
1037190404 8:16117952-16117974 ATTTTTCCACAGACCAGGGATGG - Intronic
1037376705 8:18238167-18238189 ATTTTTCCATGGATGGGGTTAGG + Intergenic
1037619472 8:20550848-20550870 ATGGTGCCACAGATGGTGCAGGG - Intergenic
1037742525 8:21618959-21618981 GTTTTTCCACAGATGGGGTGAGG - Intergenic
1037923664 8:22828176-22828198 ATATTTCCATAGATGGGAGAGGG + Intronic
1037940761 8:22949156-22949178 ATTTTTCCATAGATGTGACTGGG + Intronic
1038032973 8:23661091-23661113 ATTTTTCCACAGATGGTGGGGGG + Intergenic
1038147388 8:24911783-24911805 ATTTTAATACAGATGGGCCAAGG + Intergenic
1038195055 8:25359727-25359749 ATTTTTCCACGGATGGGGGCAGG - Intronic
1038607659 8:29024969-29024991 ATTTTTCCACCGACGGGGTGGGG - Intronic
1039187328 8:34931822-34931844 ATTTTTCTACAGAAGGGGCGGGG + Intergenic
1039586041 8:38707930-38707952 ATTTTTACACAGAAGGCGGAGGG - Intergenic
1040075034 8:43220549-43220571 CTGTTTCCACAGAGTGGGCAGGG - Intergenic
1040763086 8:50874305-50874327 ATTTTTCCACTGCTGGAGCTGGG + Intergenic
1041281569 8:56215427-56215449 ATTTTTCCACGGATGGGGAAGGG + Intronic
1041347675 8:56917957-56917979 AGTTTTCCACATATTGGGAATGG + Intergenic
1041483130 8:58345150-58345172 AATTTTCCACAGATGGGGTGGGG + Intergenic
1041835661 8:62210428-62210450 ATTTTTCCACAGAGTGGGGATGG - Intergenic
1041868401 8:62604112-62604134 ATTAGTCCTCAGATGGGACATGG - Intronic
1042704404 8:71650979-71651001 ATTTTTGCACACATGGGCCAGGG - Intergenic
1042910842 8:73824599-73824621 ATTTTTCCATGGATGGGGTTGGG + Intronic
1043005579 8:74814352-74814374 ATTTTTCCACAGACGAGGGAGGG + Intronic
1043445228 8:80313046-80313068 ATGTTTCCACAAATGGGGTGGGG + Intergenic
1044064953 8:87687945-87687967 CCTTTTCCACAGATGGGGGTTGG + Intergenic
1044206503 8:89497067-89497089 ATTTTTTTACAGATGGGGAAAGG - Intergenic
1044519042 8:93176551-93176573 ATTTTTCCATGGATGGGGTGGGG - Intergenic
1045229783 8:100292963-100292985 ATTTTTCCACAGATGGAGGTGGG + Intronic
1045364627 8:101464316-101464338 GTTTTTCAACAGACGGTGCAGGG + Intergenic
1045660765 8:104435400-104435422 ACTTTTGCAGAGATGAGGCAAGG - Intronic
1045872905 8:106946410-106946432 CTTTTTCCACAGATTGGTCCAGG + Intergenic
1045877531 8:106999736-106999758 ATTTTTCCACAGACAGGGTGGGG - Intergenic
1045946715 8:107804881-107804903 GTTTTTCCACAGATGGGGTGGGG + Intergenic
1046062682 8:109157974-109157996 ATTTTTCTACAGATGGTGAGGGG + Intergenic
1046349335 8:112985975-112985997 GTTTTTCCACAGATCGGGGGTGG - Intronic
1046498033 8:115039740-115039762 TTTTTTCAACAAATGGTGCAGGG - Intergenic
1047513900 8:125536923-125536945 ATTTTTCCATGGATTGGGGAAGG + Intergenic
1047559921 8:125975791-125975813 CTTTCTCCACAGATGGGGATGGG + Intergenic
1048562808 8:135560036-135560058 ATTTTTGCAGAGATGGGGTCTGG - Intronic
1048583441 8:135750138-135750160 ATTTTTCCACAGATGGTGGAAGG - Intergenic
1049255767 8:141612844-141612866 ATTTTTCCACGGACGGGGTAGGG + Intergenic
1050127632 9:2375836-2375858 AGTTTTCCACAGATGGTGGGTGG + Intergenic
1050575783 9:6994009-6994031 GTTTTTCCATGGATGGGGCAGGG + Intronic
1051372803 9:16372672-16372694 CCTTTTCCTCAGATGGGGAAAGG + Intergenic
1051378608 9:16431727-16431749 ATTTTTCCACAGATGTGAGTAGG + Intronic
1051516244 9:17933409-17933431 GTTTTTCCAGAGATAGGGCAGGG + Intergenic
1052189490 9:25642079-25642101 ATTTTTCCACAAATGGGGGATGG + Intergenic
1052349178 9:27440906-27440928 ATTTTTCCACAGCAGGGTTAGGG + Intronic
1052811403 9:33063794-33063816 ATTTTTCCACAGATGGTGGTGGG - Intronic
1052990299 9:34515043-34515065 ATTTTTCCTTAGATGGAGCCGGG - Intronic
1054699946 9:68403445-68403467 ATTTTTCCACAGACTGGGGGAGG - Intronic
1055354957 9:75428295-75428317 ATTTTTCCACAGACTGGGAGGGG - Intergenic
1055409979 9:76018577-76018599 ATTTTTCCACGGATGTGGGGTGG - Intronic
1055602148 9:77931064-77931086 ATTTTTCCAGGGATGGGGGTCGG - Intronic
1056235633 9:84591096-84591118 ATTTTTCCAGGGGTGGGGGAAGG - Intergenic
1056331222 9:85522823-85522845 AGTTATCCACAGATGCGGGAAGG - Intergenic
1056706451 9:88956088-88956110 ATTTTTCCACGGAGGGTGCGTGG + Intergenic
1057715204 9:97488284-97488306 TGTGTTCCACATATGGGGCAAGG - Intronic
1057984771 9:99702001-99702023 GTTTTTCCATGGATGGGGCGGGG + Intergenic
1059348040 9:113645585-113645607 ATTTTTCCACAGACAGGAGATGG - Intergenic
1059534455 9:115068470-115068492 ATTCTCCCACAGCAGGGGCATGG + Intronic
1059870701 9:118570929-118570951 ATTTTTGCAGAGATGGAGCCTGG - Intergenic
1060345958 9:122815998-122816020 ATTTTTCCACAGACTGGGGTTGG + Intronic
1060460172 9:123845276-123845298 ACTTTTCAACAGAAGGTGCAGGG + Intronic
1060605568 9:124910897-124910919 GTTTTTCCACAGATGGGGTCAGG - Intronic
1061467589 9:130794143-130794165 ATTTTTCCACAGACTGGGGATGG - Intronic
1061581177 9:131537431-131537453 ACTTTTCCACAGACTGGGTAGGG + Intergenic
1061844220 9:133377730-133377752 ATTTTTCCACAGATGGAGGCGGG + Intronic
1061902150 9:133678426-133678448 CTCTTTCCCCAGATGGGTCATGG + Intronic
1061910758 9:133721718-133721740 ATTTTTCCCCAGTTGTGTCAAGG - Intronic
1062054308 9:134463056-134463078 AATCTTCCAGAGGTGGGGCAGGG - Intergenic
1185716777 X:2349002-2349024 CTTTTTGCACAGCTGGGACAGGG + Intronic
1185728139 X:2439480-2439502 ATTTTTCCACTGATGTGGGGTGG + Intronic
1186050215 X:5584474-5584496 ATTTTTCCACAGACAGGGGTGGG + Intergenic
1186996709 X:15131400-15131422 TTTTTTCCACAGACGGGGGGTGG - Intergenic
1187013874 X:15307368-15307390 ATTTTTCCACAGATGAGGGTGGG + Intronic
1187386251 X:18851368-18851390 ATTTTTCCACAGACTGGGGTCGG - Intergenic
1187633010 X:21195842-21195864 GTTTTTCCCCTGAAGGGGCAAGG + Intergenic
1187909121 X:24094082-24094104 ATTTTTTCACAGATAGGGGGTGG - Intergenic
1188283932 X:28305112-28305134 GTTTTTCCACAGATGTGGGAAGG + Intergenic
1189168969 X:38890663-38890685 AGTTGTCCTCAGTTGGGGCAAGG - Intergenic
1189609707 X:42719094-42719116 ATTTTTCCATGGATGGGGTGGGG - Intergenic
1189622224 X:42854013-42854035 ATTAACCCACAGATGGGGAAGGG + Intergenic
1189642099 X:43084407-43084429 ATTTTTCCACAGACCAGGGACGG + Intergenic
1190027221 X:46935673-46935695 AATTTTCCACGGACGGGGGAAGG - Intronic
1190951561 X:55150285-55150307 ATTTTTCCACAGATGGGGGAAGG + Intronic
1192084480 X:68082666-68082688 GTTGTTCCACATATGGAGCATGG + Intronic
1192156313 X:68749171-68749193 ATTTTTCCACAGATGAGGCCTGG - Intergenic
1192407523 X:70901485-70901507 ATTTTTCCACGGATGGTGGGGGG + Intronic
1192454523 X:71265972-71265994 ATTTTTGGGCAGATGGGGGAGGG - Intergenic
1193310064 X:79996636-79996658 AATTTTCCACAGAAGTGACAAGG + Intergenic
1193324410 X:80162594-80162616 ATTTCTCCACAGATGGAGTGGGG - Intergenic
1193976960 X:88132711-88132733 TTTTTTCCACGGAGGGGGTAGGG - Intergenic
1194649058 X:96493159-96493181 ATTTTTCCATTGATGGGGTGAGG - Intergenic
1195124306 X:101790289-101790311 ATTTTTCCACCGATGGGGTGTGG - Intergenic
1195639980 X:107162801-107162823 ATTTTTCCACAGATGGCGGGAGG + Intronic
1195768866 X:108327326-108327348 ATTTTTCCATAGAAGGGGCCGGG - Intronic
1196386229 X:115155260-115155282 ATTTTTCTAAAGGTGGGGAAGGG + Intronic
1197008182 X:121529375-121529397 ATTTTTCTACAGATGGGGGCAGG - Intergenic
1197779041 X:130141361-130141383 CCTTTTCCACACATGGGTCAGGG - Intronic
1197808840 X:130423155-130423177 ATTTTTCCACAAATGGGGGTGGG - Intergenic
1198270898 X:135055377-135055399 ATTTTTCCATGGATGGGGCTGGG + Intergenic
1198271297 X:135058766-135058788 ATTTTTCCAAGGATGGGGGTTGG - Intergenic
1199215021 X:145253144-145253166 TTGATACCACAGATGGGGCAAGG + Intronic
1199369059 X:147023348-147023370 ATTTGTTTAAAGATGGGGCAAGG - Intergenic
1199410465 X:147516675-147516697 ATTTTTCAACAGATGTGAAAAGG - Intergenic
1199691037 X:150309132-150309154 AGTTCTCCCCAGATGGTGCAGGG - Intergenic
1200254182 X:154570664-154570686 AGTTTTCCACAGACGGGGATGGG + Intergenic
1200263587 X:154633744-154633766 AGTTTTCCACAGACGGGGATGGG - Intergenic
1201241862 Y:11965119-11965141 ATTTTTCCACAGACAGGGTTGGG + Intergenic
1201326472 Y:12765687-12765709 ATTTTTCCACAGACTGGGTGGGG - Intronic
1201943977 Y:19490761-19490783 ATTTTTCCACAGACAGAGGAGGG + Intergenic