ID: 933936023

View in Genome Browser
Species Human (GRCh38)
Location 2:87204382-87204404
Sequence GGAAACTGGTCTGGGTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933936017_933936023 3 Left 933936017 2:87204356-87204378 CCAGCTGTAACCAAGTGTCTATG 0: 46
1: 36
2: 24
3: 18
4: 88
Right 933936023 2:87204382-87204404 GGAAACTGGTCTGGGTGTCCTGG No data
933936019_933936023 -7 Left 933936019 2:87204366-87204388 CCAAGTGTCTATGTACGGAAACT No data
Right 933936023 2:87204382-87204404 GGAAACTGGTCTGGGTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933936023 Original CRISPR GGAAACTGGTCTGGGTGTCC TGG Intergenic
No off target data available for this crispr