ID: 933936257

View in Genome Browser
Species Human (GRCh38)
Location 2:87205991-87206013
Sequence TAAGCTCCGCTTCAAGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933936257_933936264 21 Left 933936257 2:87205991-87206013 CCAGGCCCTTGAAGCGGAGCTTA No data
Right 933936264 2:87206035-87206057 ATGACAGTGTGAAAGAGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933936257 Original CRISPR TAAGCTCCGCTTCAAGGGCC TGG (reversed) Intergenic
No off target data available for this crispr