ID: 933936258

View in Genome Browser
Species Human (GRCh38)
Location 2:87205996-87206018
Sequence AAGTGTAAGCTCCGCTTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933936258_933936264 16 Left 933936258 2:87205996-87206018 CCCTTGAAGCGGAGCTTACACTT No data
Right 933936264 2:87206035-87206057 ATGACAGTGTGAAAGAGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933936258 Original CRISPR AAGTGTAAGCTCCGCTTCAA GGG (reversed) Intergenic
No off target data available for this crispr