ID: 933936259

View in Genome Browser
Species Human (GRCh38)
Location 2:87205997-87206019
Sequence TAAGTGTAAGCTCCGCTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933936259_933936264 15 Left 933936259 2:87205997-87206019 CCTTGAAGCGGAGCTTACACTTA No data
Right 933936264 2:87206035-87206057 ATGACAGTGTGAAAGAGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933936259 Original CRISPR TAAGTGTAAGCTCCGCTTCA AGG (reversed) Intergenic