ID: 933936260

View in Genome Browser
Species Human (GRCh38)
Location 2:87206020-87206042
Sequence ACTGTCATGGGCTGCACTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933936260_933936264 -8 Left 933936260 2:87206020-87206042 CCCAGAGTGCAGCCCATGACAGT No data
Right 933936264 2:87206035-87206057 ATGACAGTGTGAAAGAGCACTGG No data
933936260_933936266 11 Left 933936260 2:87206020-87206042 CCCAGAGTGCAGCCCATGACAGT No data
Right 933936266 2:87206054-87206076 CTGGCTGTAGCCAAGCGTTAGGG No data
933936260_933936265 10 Left 933936260 2:87206020-87206042 CCCAGAGTGCAGCCCATGACAGT No data
Right 933936265 2:87206053-87206075 ACTGGCTGTAGCCAAGCGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933936260 Original CRISPR ACTGTCATGGGCTGCACTCT GGG (reversed) Intergenic
No off target data available for this crispr