ID: 933936261

View in Genome Browser
Species Human (GRCh38)
Location 2:87206021-87206043
Sequence CACTGTCATGGGCTGCACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933936261_933936266 10 Left 933936261 2:87206021-87206043 CCAGAGTGCAGCCCATGACAGTG No data
Right 933936266 2:87206054-87206076 CTGGCTGTAGCCAAGCGTTAGGG No data
933936261_933936264 -9 Left 933936261 2:87206021-87206043 CCAGAGTGCAGCCCATGACAGTG No data
Right 933936264 2:87206035-87206057 ATGACAGTGTGAAAGAGCACTGG No data
933936261_933936265 9 Left 933936261 2:87206021-87206043 CCAGAGTGCAGCCCATGACAGTG No data
Right 933936265 2:87206053-87206075 ACTGGCTGTAGCCAAGCGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933936261 Original CRISPR CACTGTCATGGGCTGCACTC TGG (reversed) Intergenic