ID: 933936264

View in Genome Browser
Species Human (GRCh38)
Location 2:87206035-87206057
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933936259_933936264 15 Left 933936259 2:87205997-87206019 CCTTGAAGCGGAGCTTACACTTA No data
Right 933936264 2:87206035-87206057 ATGACAGTGTGAAAGAGCACTGG No data
933936257_933936264 21 Left 933936257 2:87205991-87206013 CCAGGCCCTTGAAGCGGAGCTTA No data
Right 933936264 2:87206035-87206057 ATGACAGTGTGAAAGAGCACTGG No data
933936261_933936264 -9 Left 933936261 2:87206021-87206043 CCAGAGTGCAGCCCATGACAGTG No data
Right 933936264 2:87206035-87206057 ATGACAGTGTGAAAGAGCACTGG No data
933936260_933936264 -8 Left 933936260 2:87206020-87206042 CCCAGAGTGCAGCCCATGACAGT No data
Right 933936264 2:87206035-87206057 ATGACAGTGTGAAAGAGCACTGG No data
933936258_933936264 16 Left 933936258 2:87205996-87206018 CCCTTGAAGCGGAGCTTACACTT No data
Right 933936264 2:87206035-87206057 ATGACAGTGTGAAAGAGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type