ID: 933936265

View in Genome Browser
Species Human (GRCh38)
Location 2:87206053-87206075
Sequence ACTGGCTGTAGCCAAGCGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933936261_933936265 9 Left 933936261 2:87206021-87206043 CCAGAGTGCAGCCCATGACAGTG No data
Right 933936265 2:87206053-87206075 ACTGGCTGTAGCCAAGCGTTAGG No data
933936260_933936265 10 Left 933936260 2:87206020-87206042 CCCAGAGTGCAGCCCATGACAGT No data
Right 933936265 2:87206053-87206075 ACTGGCTGTAGCCAAGCGTTAGG No data
933936262_933936265 -2 Left 933936262 2:87206032-87206054 CCCATGACAGTGTGAAAGAGCAC No data
Right 933936265 2:87206053-87206075 ACTGGCTGTAGCCAAGCGTTAGG No data
933936263_933936265 -3 Left 933936263 2:87206033-87206055 CCATGACAGTGTGAAAGAGCACT No data
Right 933936265 2:87206053-87206075 ACTGGCTGTAGCCAAGCGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933936265 Original CRISPR ACTGGCTGTAGCCAAGCGTT AGG Intergenic