ID: 933938327

View in Genome Browser
Species Human (GRCh38)
Location 2:87225121-87225143
Sequence GGCCAAGGACACTGGCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933938327_933938336 17 Left 933938327 2:87225121-87225143 CCCCAGGGCCAGTGTCCTTGGCC No data
Right 933938336 2:87225161-87225183 TGCTGGTTTCCCCACCTCCCTGG No data
933938327_933938332 -9 Left 933938327 2:87225121-87225143 CCCCAGGGCCAGTGTCCTTGGCC No data
Right 933938332 2:87225135-87225157 TCCTTGGCCTTGGAGATCTCAGG No data
933938327_933938335 0 Left 933938327 2:87225121-87225143 CCCCAGGGCCAGTGTCCTTGGCC No data
Right 933938335 2:87225144-87225166 TTGGAGATCTCAGGCTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933938327 Original CRISPR GGCCAAGGACACTGGCCCTG GGG (reversed) Intergenic
No off target data available for this crispr