ID: 933940173

View in Genome Browser
Species Human (GRCh38)
Location 2:87238683-87238705
Sequence CTGCAACCAGCAGGGGTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933940173_933940178 1 Left 933940173 2:87238683-87238705 CCTTTCACCCCTGCTGGTTGCAG No data
Right 933940178 2:87238707-87238729 GACAAGGTCCCTGCCAACTGCGG No data
933940173_933940183 16 Left 933940173 2:87238683-87238705 CCTTTCACCCCTGCTGGTTGCAG No data
Right 933940183 2:87238722-87238744 AACTGCGGTGTGCACACTGGCGG No data
933940173_933940184 17 Left 933940173 2:87238683-87238705 CCTTTCACCCCTGCTGGTTGCAG No data
Right 933940184 2:87238723-87238745 ACTGCGGTGTGCACACTGGCGGG No data
933940173_933940181 13 Left 933940173 2:87238683-87238705 CCTTTCACCCCTGCTGGTTGCAG No data
Right 933940181 2:87238719-87238741 GCCAACTGCGGTGTGCACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933940173 Original CRISPR CTGCAACCAGCAGGGGTGAA AGG (reversed) Intergenic
No off target data available for this crispr