ID: 933940298

View in Genome Browser
Species Human (GRCh38)
Location 2:87239592-87239614
Sequence GAGTGTGTCAGCAGAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933940295_933940298 -6 Left 933940295 2:87239575-87239597 CCAGGGTCTTGTAGTGGGAGTGT No data
Right 933940298 2:87239592-87239614 GAGTGTGTCAGCAGAGTGGAGGG No data
933940289_933940298 24 Left 933940289 2:87239545-87239567 CCAAGGAGCTATCACGGAGGGCT No data
Right 933940298 2:87239592-87239614 GAGTGTGTCAGCAGAGTGGAGGG No data
933940286_933940298 29 Left 933940286 2:87239540-87239562 CCTGGCCAAGGAGCTATCACGGA No data
Right 933940298 2:87239592-87239614 GAGTGTGTCAGCAGAGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933940298 Original CRISPR GAGTGTGTCAGCAGAGTGGA GGG Intergenic
No off target data available for this crispr