ID: 933945178

View in Genome Browser
Species Human (GRCh38)
Location 2:87279842-87279864
Sequence CTGCACCCACAAGAAAGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933945178_933945189 30 Left 933945178 2:87279842-87279864 CCTCAGCTTTCTTGTGGGTGCAG No data
Right 933945189 2:87279895-87279917 ACAATGACTTCAGCTTTCCAGGG No data
933945178_933945188 29 Left 933945178 2:87279842-87279864 CCTCAGCTTTCTTGTGGGTGCAG No data
Right 933945188 2:87279894-87279916 GACAATGACTTCAGCTTTCCAGG No data
933945178_933945180 -10 Left 933945178 2:87279842-87279864 CCTCAGCTTTCTTGTGGGTGCAG No data
Right 933945180 2:87279855-87279877 GTGGGTGCAGCAGGCCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933945178 Original CRISPR CTGCACCCACAAGAAAGCTG AGG (reversed) Intergenic