ID: 933945181

View in Genome Browser
Species Human (GRCh38)
Location 2:87279869-87279891
Sequence GAGCAGGGACTGGGCCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933945181_933945189 3 Left 933945181 2:87279869-87279891 CCACCCAGGCCCAGTCCCTGCTC No data
Right 933945189 2:87279895-87279917 ACAATGACTTCAGCTTTCCAGGG No data
933945181_933945188 2 Left 933945181 2:87279869-87279891 CCACCCAGGCCCAGTCCCTGCTC No data
Right 933945188 2:87279894-87279916 GACAATGACTTCAGCTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933945181 Original CRISPR GAGCAGGGACTGGGCCTGGG TGG (reversed) Intergenic