ID: 933945183

View in Genome Browser
Species Human (GRCh38)
Location 2:87279873-87279895
Sequence TCGTGAGCAGGGACTGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933945183_933945189 -1 Left 933945183 2:87279873-87279895 CCAGGCCCAGTCCCTGCTCACGA No data
Right 933945189 2:87279895-87279917 ACAATGACTTCAGCTTTCCAGGG No data
933945183_933945188 -2 Left 933945183 2:87279873-87279895 CCAGGCCCAGTCCCTGCTCACGA No data
Right 933945188 2:87279894-87279916 GACAATGACTTCAGCTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933945183 Original CRISPR TCGTGAGCAGGGACTGGGCC TGG (reversed) Intergenic