ID: 933945184

View in Genome Browser
Species Human (GRCh38)
Location 2:87279878-87279900
Sequence CATTGTCGTGAGCAGGGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933945184_933945188 -7 Left 933945184 2:87279878-87279900 CCCAGTCCCTGCTCACGACAATG No data
Right 933945188 2:87279894-87279916 GACAATGACTTCAGCTTTCCAGG No data
933945184_933945189 -6 Left 933945184 2:87279878-87279900 CCCAGTCCCTGCTCACGACAATG No data
Right 933945189 2:87279895-87279917 ACAATGACTTCAGCTTTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933945184 Original CRISPR CATTGTCGTGAGCAGGGACT GGG (reversed) Intergenic