ID: 933945189

View in Genome Browser
Species Human (GRCh38)
Location 2:87279895-87279917
Sequence ACAATGACTTCAGCTTTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933945185_933945189 -7 Left 933945185 2:87279879-87279901 CCAGTCCCTGCTCACGACAATGA No data
Right 933945189 2:87279895-87279917 ACAATGACTTCAGCTTTCCAGGG No data
933945184_933945189 -6 Left 933945184 2:87279878-87279900 CCCAGTCCCTGCTCACGACAATG No data
Right 933945189 2:87279895-87279917 ACAATGACTTCAGCTTTCCAGGG No data
933945183_933945189 -1 Left 933945183 2:87279873-87279895 CCAGGCCCAGTCCCTGCTCACGA No data
Right 933945189 2:87279895-87279917 ACAATGACTTCAGCTTTCCAGGG No data
933945182_933945189 0 Left 933945182 2:87279872-87279894 CCCAGGCCCAGTCCCTGCTCACG No data
Right 933945189 2:87279895-87279917 ACAATGACTTCAGCTTTCCAGGG No data
933945181_933945189 3 Left 933945181 2:87279869-87279891 CCACCCAGGCCCAGTCCCTGCTC No data
Right 933945189 2:87279895-87279917 ACAATGACTTCAGCTTTCCAGGG No data
933945178_933945189 30 Left 933945178 2:87279842-87279864 CCTCAGCTTTCTTGTGGGTGCAG No data
Right 933945189 2:87279895-87279917 ACAATGACTTCAGCTTTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933945189 Original CRISPR ACAATGACTTCAGCTTTCCA GGG Intergenic
No off target data available for this crispr