ID: 933945980

View in Genome Browser
Species Human (GRCh38)
Location 2:87286537-87286559
Sequence CTGCATGTGGAGTTGAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933945974_933945980 6 Left 933945974 2:87286508-87286530 CCAAGGAAAGCTGTTAGACAGCT No data
Right 933945980 2:87286537-87286559 CTGCATGTGGAGTTGAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933945980 Original CRISPR CTGCATGTGGAGTTGAGGGA GGG Intergenic
No off target data available for this crispr