ID: 933946543

View in Genome Browser
Species Human (GRCh38)
Location 2:87291011-87291033
Sequence GCACAGCCTGCAAGCCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933946541_933946543 -8 Left 933946541 2:87290996-87291018 CCACACAGCACCACAGCACAGCC No data
Right 933946543 2:87291011-87291033 GCACAGCCTGCAAGCCTTCCTGG No data
933946539_933946543 18 Left 933946539 2:87290970-87290992 CCTGACTGTTGTCTTCAGTCTTG No data
Right 933946543 2:87291011-87291033 GCACAGCCTGCAAGCCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933946543 Original CRISPR GCACAGCCTGCAAGCCTTCC TGG Intergenic
No off target data available for this crispr