ID: 933946742

View in Genome Browser
Species Human (GRCh38)
Location 2:87293140-87293162
Sequence GTTGAATAACTAGGAACAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933946735_933946742 10 Left 933946735 2:87293107-87293129 CCCAGCCCATTTTTTCTTTTATG No data
Right 933946742 2:87293140-87293162 GTTGAATAACTAGGAACAACAGG No data
933946734_933946742 18 Left 933946734 2:87293099-87293121 CCACTGTGCCCAGCCCATTTTTT 0: 13
1: 199
2: 1749
3: 9315
4: 43792
Right 933946742 2:87293140-87293162 GTTGAATAACTAGGAACAACAGG No data
933946736_933946742 9 Left 933946736 2:87293108-87293130 CCAGCCCATTTTTTCTTTTATGG No data
Right 933946742 2:87293140-87293162 GTTGAATAACTAGGAACAACAGG No data
933946739_933946742 4 Left 933946739 2:87293113-87293135 CCATTTTTTCTTTTATGGCGTCC No data
Right 933946742 2:87293140-87293162 GTTGAATAACTAGGAACAACAGG No data
933946738_933946742 5 Left 933946738 2:87293112-87293134 CCCATTTTTTCTTTTATGGCGTC No data
Right 933946742 2:87293140-87293162 GTTGAATAACTAGGAACAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933946742 Original CRISPR GTTGAATAACTAGGAACAAC AGG Intergenic
No off target data available for this crispr