ID: 933947466

View in Genome Browser
Species Human (GRCh38)
Location 2:87299002-87299024
Sequence AAGGAGAGACAGAAGGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933947466_933947476 1 Left 933947466 2:87299002-87299024 CCATGCCCCTTCTGTCTCTCCTT No data
Right 933947476 2:87299026-87299048 CATCCTGGGGTTTGTGGTAGAGG No data
933947466_933947473 -5 Left 933947466 2:87299002-87299024 CCATGCCCCTTCTGTCTCTCCTT No data
Right 933947473 2:87299020-87299042 TCCTTCCATCCTGGGGTTTGTGG No data
933947466_933947478 16 Left 933947466 2:87299002-87299024 CCATGCCCCTTCTGTCTCTCCTT No data
Right 933947478 2:87299041-87299063 GGTAGAGGATTACCCAGTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933947466 Original CRISPR AAGGAGAGACAGAAGGGGCA TGG (reversed) Intergenic
No off target data available for this crispr