ID: 933947995

View in Genome Browser
Species Human (GRCh38)
Location 2:87304273-87304295
Sequence ACTATGTAGGCCCATACCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933947995_933948005 18 Left 933947995 2:87304273-87304295 CCTTAGGTATGGGCCTACATAGT No data
Right 933948005 2:87304314-87304336 GTAGAATAGATAGGGGGTGGGGG No data
933947995_933948002 15 Left 933947995 2:87304273-87304295 CCTTAGGTATGGGCCTACATAGT No data
Right 933948002 2:87304311-87304333 AGTGTAGAATAGATAGGGGGTGG No data
933947995_933948000 11 Left 933947995 2:87304273-87304295 CCTTAGGTATGGGCCTACATAGT No data
Right 933948000 2:87304307-87304329 AAAGAGTGTAGAATAGATAGGGG No data
933947995_933947998 9 Left 933947995 2:87304273-87304295 CCTTAGGTATGGGCCTACATAGT No data
Right 933947998 2:87304305-87304327 CCAAAGAGTGTAGAATAGATAGG No data
933947995_933948004 17 Left 933947995 2:87304273-87304295 CCTTAGGTATGGGCCTACATAGT No data
Right 933948004 2:87304313-87304335 TGTAGAATAGATAGGGGGTGGGG No data
933947995_933947999 10 Left 933947995 2:87304273-87304295 CCTTAGGTATGGGCCTACATAGT No data
Right 933947999 2:87304306-87304328 CAAAGAGTGTAGAATAGATAGGG No data
933947995_933948003 16 Left 933947995 2:87304273-87304295 CCTTAGGTATGGGCCTACATAGT No data
Right 933948003 2:87304312-87304334 GTGTAGAATAGATAGGGGGTGGG No data
933947995_933948001 12 Left 933947995 2:87304273-87304295 CCTTAGGTATGGGCCTACATAGT No data
Right 933948001 2:87304308-87304330 AAGAGTGTAGAATAGATAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933947995 Original CRISPR ACTATGTAGGCCCATACCTA AGG (reversed) Intergenic