ID: 933947998 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:87304305-87304327 |
Sequence | CCAAAGAGTGTAGAATAGAT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
933947996_933947998 | -4 | Left | 933947996 | 2:87304286-87304308 | CCTACATAGTGATTTTCTTCCAA | No data | ||
Right | 933947998 | 2:87304305-87304327 | CCAAAGAGTGTAGAATAGATAGG | No data | ||||
933947995_933947998 | 9 | Left | 933947995 | 2:87304273-87304295 | CCTTAGGTATGGGCCTACATAGT | No data | ||
Right | 933947998 | 2:87304305-87304327 | CCAAAGAGTGTAGAATAGATAGG | No data | ||||
933947994_933947998 | 15 | Left | 933947994 | 2:87304267-87304289 | CCTGGTCCTTAGGTATGGGCCTA | No data | ||
Right | 933947998 | 2:87304305-87304327 | CCAAAGAGTGTAGAATAGATAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
933947998 | Original CRISPR | CCAAAGAGTGTAGAATAGAT AGG | Intergenic | ||