ID: 933948000

View in Genome Browser
Species Human (GRCh38)
Location 2:87304307-87304329
Sequence AAAGAGTGTAGAATAGATAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933947995_933948000 11 Left 933947995 2:87304273-87304295 CCTTAGGTATGGGCCTACATAGT No data
Right 933948000 2:87304307-87304329 AAAGAGTGTAGAATAGATAGGGG No data
933947996_933948000 -2 Left 933947996 2:87304286-87304308 CCTACATAGTGATTTTCTTCCAA No data
Right 933948000 2:87304307-87304329 AAAGAGTGTAGAATAGATAGGGG No data
933947994_933948000 17 Left 933947994 2:87304267-87304289 CCTGGTCCTTAGGTATGGGCCTA No data
Right 933948000 2:87304307-87304329 AAAGAGTGTAGAATAGATAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933948000 Original CRISPR AAAGAGTGTAGAATAGATAG GGG Intergenic