ID: 933948003 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:87304312-87304334 |
| Sequence | GTGTAGAATAGATAGGGGGT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 933947994_933948003 | 22 | Left | 933947994 | 2:87304267-87304289 | CCTGGTCCTTAGGTATGGGCCTA | No data | ||
| Right | 933948003 | 2:87304312-87304334 | GTGTAGAATAGATAGGGGGTGGG | No data | ||||
| 933947996_933948003 | 3 | Left | 933947996 | 2:87304286-87304308 | CCTACATAGTGATTTTCTTCCAA | No data | ||
| Right | 933948003 | 2:87304312-87304334 | GTGTAGAATAGATAGGGGGTGGG | No data | ||||
| 933947995_933948003 | 16 | Left | 933947995 | 2:87304273-87304295 | CCTTAGGTATGGGCCTACATAGT | No data | ||
| Right | 933948003 | 2:87304312-87304334 | GTGTAGAATAGATAGGGGGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 933948003 | Original CRISPR | GTGTAGAATAGATAGGGGGT GGG | Intergenic | ||