ID: 933952499

View in Genome Browser
Species Human (GRCh38)
Location 2:87342626-87342648
Sequence GGGTGAACAAGCTCTCGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933952496_933952499 -8 Left 933952496 2:87342611-87342633 CCCTAAGAGGGCTGGGGGTGAAC No data
Right 933952499 2:87342626-87342648 GGGTGAACAAGCTCTCGGCCCGG No data
933952489_933952499 18 Left 933952489 2:87342585-87342607 CCTAGTGGGAGAAGCATGTGAAA No data
Right 933952499 2:87342626-87342648 GGGTGAACAAGCTCTCGGCCCGG No data
933952488_933952499 24 Left 933952488 2:87342579-87342601 CCTAGGCCTAGTGGGAGAAGCAT No data
Right 933952499 2:87342626-87342648 GGGTGAACAAGCTCTCGGCCCGG No data
933952497_933952499 -9 Left 933952497 2:87342612-87342634 CCTAAGAGGGCTGGGGGTGAACA No data
Right 933952499 2:87342626-87342648 GGGTGAACAAGCTCTCGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933952499 Original CRISPR GGGTGAACAAGCTCTCGGCC CGG Intergenic
No off target data available for this crispr