ID: 933952683

View in Genome Browser
Species Human (GRCh38)
Location 2:87343807-87343829
Sequence GCTCCTGGCAAGGCACAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933952677_933952683 15 Left 933952677 2:87343769-87343791 CCGCTGCGCTCATGACACTCTCA No data
Right 933952683 2:87343807-87343829 GCTCCTGGCAAGGCACAACCAGG No data
933952676_933952683 18 Left 933952676 2:87343766-87343788 CCACCGCTGCGCTCATGACACTC No data
Right 933952683 2:87343807-87343829 GCTCCTGGCAAGGCACAACCAGG No data
933952675_933952683 29 Left 933952675 2:87343755-87343777 CCACACAACTACCACCGCTGCGC No data
Right 933952683 2:87343807-87343829 GCTCCTGGCAAGGCACAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933952683 Original CRISPR GCTCCTGGCAAGGCACAACC AGG Intergenic
No off target data available for this crispr