ID: 933955037

View in Genome Browser
Species Human (GRCh38)
Location 2:87356783-87356805
Sequence CTCTGGCCCTGCCTTGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933955037_933955044 24 Left 933955037 2:87356783-87356805 CCAGGGCCAAGGCAGGGCCAGAG No data
Right 933955044 2:87356830-87356852 GATTTGCCCTGCCCCAACGTTGG No data
933955037_933955042 -2 Left 933955037 2:87356783-87356805 CCAGGGCCAAGGCAGGGCCAGAG No data
Right 933955042 2:87356804-87356826 AGATGGACTTGGAAGTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933955037 Original CRISPR CTCTGGCCCTGCCTTGGCCC TGG (reversed) Intergenic
No off target data available for this crispr