ID: 933955044

View in Genome Browser
Species Human (GRCh38)
Location 2:87356830-87356852
Sequence GATTTGCCCTGCCCCAACGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933955041_933955044 7 Left 933955041 2:87356800-87356822 CCAGAGATGGACTTGGAAGTGTC No data
Right 933955044 2:87356830-87356852 GATTTGCCCTGCCCCAACGTTGG No data
933955037_933955044 24 Left 933955037 2:87356783-87356805 CCAGGGCCAAGGCAGGGCCAGAG No data
Right 933955044 2:87356830-87356852 GATTTGCCCTGCCCCAACGTTGG No data
933955039_933955044 18 Left 933955039 2:87356789-87356811 CCAAGGCAGGGCCAGAGATGGAC No data
Right 933955044 2:87356830-87356852 GATTTGCCCTGCCCCAACGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933955044 Original CRISPR GATTTGCCCTGCCCCAACGT TGG Intergenic
No off target data available for this crispr