ID: 933956277

View in Genome Browser
Species Human (GRCh38)
Location 2:87375337-87375359
Sequence CGCTGGCCGAGGTGAAGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933956277_933956283 11 Left 933956277 2:87375337-87375359 CCTGGACTTCACCTCGGCCAGCG No data
Right 933956283 2:87375371-87375393 GGGTTAATGTTAACTGCACGAGG No data
933956277_933956281 -9 Left 933956277 2:87375337-87375359 CCTGGACTTCACCTCGGCCAGCG No data
Right 933956281 2:87375351-87375373 CGGCCAGCGAAGGAGAGAGAGGG No data
933956277_933956280 -10 Left 933956277 2:87375337-87375359 CCTGGACTTCACCTCGGCCAGCG No data
Right 933956280 2:87375350-87375372 TCGGCCAGCGAAGGAGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933956277 Original CRISPR CGCTGGCCGAGGTGAAGTCC AGG (reversed) Intergenic
No off target data available for this crispr