ID: 933956281

View in Genome Browser
Species Human (GRCh38)
Location 2:87375351-87375373
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933956273_933956281 22 Left 933956273 2:87375306-87375328 CCCGAGAGAGTGGACGTCAGAAC No data
Right 933956281 2:87375351-87375373 CGGCCAGCGAAGGAGAGAGAGGG No data
933956272_933956281 23 Left 933956272 2:87375305-87375327 CCCCGAGAGAGTGGACGTCAGAA No data
Right 933956281 2:87375351-87375373 CGGCCAGCGAAGGAGAGAGAGGG No data
933956271_933956281 24 Left 933956271 2:87375304-87375326 CCCCCGAGAGAGTGGACGTCAGA No data
Right 933956281 2:87375351-87375373 CGGCCAGCGAAGGAGAGAGAGGG No data
933956277_933956281 -9 Left 933956277 2:87375337-87375359 CCTGGACTTCACCTCGGCCAGCG No data
Right 933956281 2:87375351-87375373 CGGCCAGCGAAGGAGAGAGAGGG No data
933956274_933956281 21 Left 933956274 2:87375307-87375329 CCGAGAGAGTGGACGTCAGAACT No data
Right 933956281 2:87375351-87375373 CGGCCAGCGAAGGAGAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr