ID: 933956283

View in Genome Browser
Species Human (GRCh38)
Location 2:87375371-87375393
Sequence GGGTTAATGTTAACTGCACG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933956279_933956283 0 Left 933956279 2:87375348-87375370 CCTCGGCCAGCGAAGGAGAGAGA No data
Right 933956283 2:87375371-87375393 GGGTTAATGTTAACTGCACGAGG No data
933956282_933956283 -6 Left 933956282 2:87375354-87375376 CCAGCGAAGGAGAGAGAGGGTTA No data
Right 933956283 2:87375371-87375393 GGGTTAATGTTAACTGCACGAGG No data
933956277_933956283 11 Left 933956277 2:87375337-87375359 CCTGGACTTCACCTCGGCCAGCG No data
Right 933956283 2:87375371-87375393 GGGTTAATGTTAACTGCACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933956283 Original CRISPR GGGTTAATGTTAACTGCACG AGG Intergenic
No off target data available for this crispr